Castilleja lemmonii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records935

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Castilleja lemmonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility935 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF935 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI≈827 Mbp

01Narrative

Castilleja lemmonii is a species of Indian paintbrush known by the common name Lemmon's Indian paintbrush or meadow paintbrush. It is native to the higher elevations of the Sierra Nevada and Southern Cascade Range in California, and just into western Nevada. It grows in moist meadows. Castilleja lemmonii, group of deep purple-pink plants in meadow

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja lemmonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEF103693.1 ↗687 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGG …

Castilleja lemmonii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Castilleja lemmonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈827 412 985 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Castilleja lemmonii0.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-fedorov

CCDB · book-fedorov — Gillett (D. n. 1954)

n 122×CCDB · book-ipcn67-71 · CCDB · Cave1956supp

CCDB · book-ipcn67-71 — HECKARD, L.R. 1968. Chromosome numbers and polyploidy in Castilleja (Scrophulariaceae). Brittonia 20: 212-226.

CCDB · Cave1956supp — Gillett 1954

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type935 records

Wild obs. + sensor654

Museum / vouchered281

Origin

Native30

Range

Area of Occupancy AOO1 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 412≤1 km 59≤10 km 24>10 km 21

516 georeferenced · 138 without coordinates

Open the mapobservation + sensor654

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 162≤10 km 60>10 km 2

233 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence281

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	30
Pullman, US	21
Davis, US	17
Fredericton Stock Culture Collectionlocation not on record	15
Santa Barbara, US	10
Riverside, US	9
Moscow, US	8
Los Angeles, US	7
San Diego, US	6
Northridge, US	5
WTUlocation not on record	5
Bronx, US	4
San Jose, US	4
Arcata, US	3
CASlocation not on record	3
US	3
Angwin, US	3
Long Beach, US	2
San Francisco, US	2
San Luis Obispo, US	2
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Columbia, US	1
Phoenix, US	1
Severin-McDaniel Insect Collectionlocation not on record	1

25 institutions · 164 of 281 vouchered records shown · 117 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)