Castilleja elmeri

Fernald · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records419

Data sources7

Biological traits8

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Castilleja elmeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF419 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Castilleja elmeri là loài thực vật có hoa thuộc họ Cỏ chổi. Loài này được Fernald mô tả khoa học đầu tiên năm 1898.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.25 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteobligatory

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja elmeri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220099.1 ↗313 bpCanada · 1997

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGTAAGTTGCGCCCGAAGCCTCACTTCCGAGGGCACGCCTGCTTGGGCATCACTCATC …

Castilleja elmeri voucher CCDB-24910-D07 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type419 records

Wild obs. + sensor223

Museum / vouchered196

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 126≤1 km 11≤10 km 5>10 km 4

146 georeferenced · 77 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 24≤1 km 66≤10 km 50>10 km 1

141 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	121
Pullman, US	46
Victoria, CA	10
Moscow, US	7
Vancouver, CA	4
Corvallis, US	4
University of British Columbia, Herbariumlocation not on record	2

7 institutions · 194 of 196 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Castilleja elmeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Subalpine meadow slope.open alpine meadows

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 10.9–12.3

Seasonal swing summer↔winter17.9 °C

Max temp (day)18.8 °C 17.8–19.7

Min temp (night)6.20 °C 5.60–6.70

Precipitation63.2 mm/mo 56.6–69.8

Air humidity57.0 % 55.8–58.2

Moisture balance-55.0 mm/mo -71.2–-38.8

Vapour deficit590 Pa 548–632

Wind speed3.20 m/s 2.90–3.50

Cloud cover35.2 % 34.3–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)