Castilleja elegans

Malte · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records489

Data sources8

Biological traits13

DNA specimens24

eDNA detections12

Sources8 archives

Databases and archives Castilleja elegans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility489 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF489 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Castilleja elegans, la Castilléjie élégante, est une espèce de plantes à fleurs de la famille des Scrophulariacées, ou de la famille des Orobanchacées selon la classification APG III. Elle est originaire d'Amérique du Nord et d'Asie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size403 mm²

Plant height0.177 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)286 mg/g

Specific leaf area (SLA)7.11 mm²/mg

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja elegans has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes5

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218818.1 ↗249 bpCanada · 2005

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Castilleja elegans voucher CCDB-18342-E4 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL8★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Castilleja elegans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.

CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1981a. In Chromosome number reports LXX. Taxon 30: 70–72.

CCDB · book-ipcn66 — Zhukova 1966

CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type489 records

Wild obs. + sensor172

Museum / vouchered317

Range

Area of Occupancy AOO1 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 71≤1 km 11≤10 km 37>10 km 23

142 georeferenced · 30 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤1 km 7≤10 km 15>10 km 3

25 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	158
WTUlocation not on record	34
Whitehorse, CA	17
Moscow State Universitylocation not on record	15
Vancouver, CA	14
Canadian Museum of Naturelocation not on record	10
Anchorage, US	10
Yukon Universitylocation not on record	7
University of Alberta Museumslocation not on record	7
Acadia Universitylocation not on record	6
Chongqing Museumlocation not on record	4
Montréal, CA	4
St. Paul, US	3
Research Collection of B. A. Bennettlocation not on record	2
Institute of the biological problems of the North FEB RASlocation not on record	2
Université Lavallocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Moscow, US	2
Oulu, FI	1
Beijing, CN	1
Flagstaff, US	1
Stockholm, SE	1
Saint Louis, US	1
Chapel Hill, US	1
MeiseBGlocation not on record	1
Millersville, US	1

26 institutions · 307 of 317 vouchered records shown · 10 without an institution code

09Environmental DNA12 detections

Where the DNA of Castilleja elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Riverine Poplar ForestSpruce-Tussock

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 7.90–13.0

Seasonal swing summer↔winter39.7 °C

Max temp (day)13.9 °C 11.7–18.0

Min temp (night)6.70 °C 5.00–8.60

Precipitation59.4 mm/mo 35.4–74.0

Air humidity59.9 % 57.6–63.9

Moisture balance-47.9 mm/mo -66.5–-18.2

Vapour deficit498 Pa 384–633

Wind speed4.30 m/s 2.40–4.80

Cloud cover69.3 % 51.2–71.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)