Castilleja arachnoidea

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records1 245

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Castilleja arachnoidea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 245 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Castilleja arachnoidea is a species of Indian paintbrush known by the common name cobwebby Indian paintbrush. It is native to northern California and Nevada and southern Oregon, where it is a resident of the local mountain ranges and the Modoc Plateau. This is a small woolly perennial herb growing up to about 30 centimeters in maximum height. Its narrow, pointed leaves are a few centimeters long and may be lobed. The inflorescence is coated in cobwebby fibers. The bracts are yellowish to dull red and the pouchlike flowers which emerge between them are greenish yellow to purplish red in color. The fruit is a capsule about a centimeter long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja arachnoidea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEF103691.1 ↗688 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGAGCAGACCGCGCACACGTTAAACCAAACAAGGCACGTGGCCCGG …

Castilleja arachnoidea 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Castilleja arachnoidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-fedorov

CCDB · book-fedorov — Gillett (D. n. 1954)

CCDB · book-fedorov — Heckard (D. n. 1958)

n 122×CCDB · book-ipcn67-71 · CCDB · Cave1956supp

CCDB · book-ipcn67-71 — HECKARD, L.R. 1968. Chromosome numbers and polyploidy in Castilleja (Scrophulariaceae). Brittonia 20: 212-226.

CCDB · Cave1956supp — Gillett 1954

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 245 records

Wild obs. + sensor682

Museum / vouchered563

Origin

Native9

Range

Area of Occupancy AOO1 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 377≤1 km 61≤10 km 27>10 km 24

489 georeferenced · 193 without coordinates

Open the mapobservation + sensor682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 13≤1 km 235≤10 km 140>10 km 12

400 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence563

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	72
Arcata, US	65
WTUlocation not on record	47
Angwin, US	43
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	36
Pullman, US	29
Moscow, US	15
Bronx, US	14
Ashland, US	14
CASlocation not on record	13
Claremont, US	10
Davis, US	7
Chapel Hill, US	7
Santa Barbara, US	6
Bend, US	5
San Jose, US	4
San Francisco, US	4
Riverside, US	3
Provo, US	3
Canadian Department of Agriculturelocation not on record	3
San Luis Obispo, US	2
KNFHClocation not on record	2
San Diego, US	2
Los Angeles, US	2
Bangkok, TH	2
ASUlocation not on record	2
Boise, US	2
Turlock, US	2
STNFlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	1
Brookings, US	1
University of Stellenboschlocation not on record	1
Portland, US	1
Flagstaff, US	1
Vancouver, CA	1
Wuzhou, CN	1
Philadelphia, US	1
Tampa, US	1
Kew, GB	1
Dekalb, US	1

40 institutions · 429 of 563 vouchered records shown · 134 without an institution code

At a glance

Sources8 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 245 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions31 of 40 geolocated

Record type1 245 records