Castilleja ambigua

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Castilleja

At a glance

Occurrence records491

Data sources10

Biological traits13

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Castilleja ambigua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility491 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF491 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Castilleja ambigua là loài thực vật có hoa thuộc họ Cỏ chổi. Loài này được Hook. & Arn. mô tả khoa học đầu tiên năm 1833.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass1.32 mg

Seed mass max2.52 mg

Seed mass min0.129 mg

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castilleja ambigua has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219041.1 ↗364 bpUSA · 2009

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCACGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATT …

Castilleja ambigua voucher CCDB-24910-G07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Castilleja ambigua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 124×CCDB · book-ipcn65 · CCDB · ipcn-api-dl

CCDB · book-ipcn65 — Anderson 1965

CCDB · ipcn-api-dl — Chuang, T. I. & L. R. Heckard. 1982. Chromosome numbers of Orthocarpus and related monotypic genera (Scrophulariaceae: subtribe Castillejinae). Brittonia 34: 89–101.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type491 records

Wild obs. + sensor425

Museum / vouchered66

Origin

Native1

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 245≤1 km 49≤10 km 9>10 km 40

343 georeferenced · 82 without coordinates

Open the mapobservation + sensor425

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 14≤10 km 27>10 km 3

44 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	24
Santa Cruz, US	8
Tacoma, US	6
Riverside, US	4
University of British Columbia, Herbariumlocation not on record	3
Los Angeles, US	3
College Park, US	2
Bloomington, US	2
Logan, US	1
Claremont, US	1
Arcata, US	1
San Jose, US	1
US	1
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
San Luis Obispo, US	1

16 institutions · 60 of 66 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Castilleja ambigua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

in sandy area along outlet to the Pacific Oc…Tidal flatsUpper zone of tidal flats

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 13.0–15.2

Seasonal swing summer↔winter13.1 °C

Max temp (day)18.1 °C 16.9–19.2

Min temp (night)11.7 °C 9.50–11.8

Precipitation53.3 mm/mo 31.9–69.5

Air humidity61.0 % 59.5–65.2

Moisture balance-64.1 mm/mo -107–-47.1

Vapour deficit570 Pa 565–682

Wind speed1.90 m/s 1.00–3.10

Cloud cover39.7 % 37.3–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)