Castanospora alphandii

(F.Muell.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Castanospora

At a glance

Occurrence records605

Data sources9

Biological traits41

DNA specimens6

eDNA detections4

Sources9 archives

Databases and archives Castanospora alphandii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility605 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources41 traits

Occurrence & distributionGBIF605 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Castanospora is a monotypic genus of trees, constituting part of the plant family Sapindaceae. The sole species Castanospora alphandii, commonly known as brown tamarind, grows naturally in the Australian rainforests of north-eastern New South Wales and eastern Queensland as far north as the Wet Tropics rainforests of north-eastern Queensland. Brown tamarind is known in horticulture, though it is only distantly related to the true tamarind.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology21

Fruit length27.5 mm

Fruit width45 mm

Leaf length150 mm

Leaf length max300 mm

Leaf length min120 mm

Leaf mass per area97.93 g/m2

Leaf size4 380 mm²

Leaf width35 mm

Leaf width max40 mm

Leaf width min20 mm

Petiole length9 cm

Plant height34 m

Plant height max30 m

Seed length24 mm

Seed mass2 000 mg

⚠ sources differ — AusTraits: 2 000 mg · GIFT: 2 765 mg

Seed mass max3 530 mg

Seed mass min2 000 mg

Seed volume4 900 mm³

Seed volume max4 900 mm³

Seed volume min4 900 mm³

Seed width24.5 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnyyyynnnn

Life formtree

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesscompound

Leaf shapenarrowly_elliptical oblong ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castanospora alphandii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895499.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAACCCCGGTGTTAACGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGC …

Castanospora alphandii voucher 1076419091 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type605 records

Wild obs. + sensor223

Museum / vouchered289

Cultivated / captive2

Other91

Origin

Native26

Introduced1

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 141≤1 km 13≤10 km 11>10 km 4

169 georeferenced · 54 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 27≤1 km 37≤10 km 86>10 km 48

198 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence289

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	107
Brisbane, AU	64
Museo Entomologico de Leonlocation not on record	28
Mount Annan, AU	27
Canberra, AU	15
Armidale, AU	10
James Cook Townsvillelocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Kew, GB	2
Parkville, AU	2
Honolulu, US	2
Palmerston, AU	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
Glocation not on record	1
ASUlocation not on record	1

15 institutions · 269 of 289 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Castanospora alphandii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 16.1–21.2

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C 20.6–27.4

Min temp (night)14.4 °C 12.0–14.9

Precipitation52.7 mm/mo 23.0–116

Air humidity61.0 % 46.9–63.3

Moisture balance-40.1 mm/mo -122–2.90

Vapour deficit823 Pa 675–1,464

Wind speed3.10 m/s 3.10–3.80

Cloud cover25.6 % 19.6–30.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)