Castanopsis purpurella

(Miq.) N.P.Balakr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Castanopsis

At a glance

Occurrence records4

Data sources6

Biological traits37

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Castanopsis purpurella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources37 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

01Narrative

Castanopsis hystrix là một loài thực vật có hoa trong họ Fagaceae. Loài này được (Miq.) N.P.Balakr. mô tả khoa học đầu tiên năm 1983.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length32.5 mm

Fruit length max40 mm

Fruit length min25 mm

Leaf length65 mm

Leaf length max90 mm

Leaf length min40 mm

Leaf width27.5 mm

Leaf width max40 mm

Leaf width min15 mm

Plant height25 m

⚠ sources differ — GIFT: 25 m · TRY: 30 m

Seed mass94.32 mg

Seed mass max94.34 mg

Seed mass min94.3 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 500 m

Elevation mean815 m

Elevation min30 m

Epiphyteterrestrial

Growth formtree

Leaf formelliptic

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)10.5 mm²/mg

Wood density733 mg/cm³

Other traits6

Leaf marginentire

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max12.29 mm²/mg

Sla min7.04 mm²/mg

03Chemical composition4 compounds

Compounds documented for Castanopsis purpurella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavan-3-ols4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S,10S)-2,10-bis(3,4-dihydroxyphenyl)-3,5-dihydroxy-3,4,9,10-tetrahydro-2H-pyrano[2,3-f]chromen-8-one	present	LOTUS
(4R,8R,9S)-4,8-bis(3,4-dihydroxyphenyl)-5,9-dihydroxy-4,8,9,10-tetrahydro-3H-pyrano[2,3-h]chromen-2-one	present	LOTUS
(4S,8R,9S)-4,8-bis(3,4-dihydroxyphenyl)-5,9-dihydroxy-4,8,9,10-tetrahydro-3H-pyrano[2,3-h]chromen-2-one	present	LOTUS
9,10-Dihydro-10-(3,4-dihydroxyphenyl)-pyrano(2,3-h)catechin-8-one	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castanopsis purpurella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR936138.1 ↗160 350 bpIndia

ACGT

GCGACGAAGAATCAAATTATCACTATATTTATTCCTTTTTCTACTTCTTCTTCCAAGTGCAGGATAACCCCAAGGGGTTGCGGGTTTTTT …

Castanopsis purpurella chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4

1 institutions · 4 of 4 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)