Castanopsis kawakamii

Hayata · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Castanopsis

At a glance

Occurrence records448

Data sources9

Biological traits30

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Castanopsis kawakamii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF448 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Castanopsis kawakamii is a species of plant in the family Fagaceae. It is found in China, Taiwan, and Vietnam. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length13.5 mm

Fruit length max15 mm

Fruit length min12 mm

Fruit width18.5 mm

Fruit width max20 mm

Fruit width min17 mm

Leaf length90 mm

Leaf length max120 mm

Leaf length min60 mm

Leaf width35 mm

Leaf width max50 mm

Leaf width min20 mm

Plant height21.5 m

⚠ sources differ — GIFT: 21.5 m · TRY: 40 m

Plant height max28 m

Plant height min15 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean1 000 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density590 mg/cm³

⚠ sources differ — TRY: 590 mg/cm³ · GIFT: 796 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castanopsis kawakamii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR199454.1 ↗464 bpChina

ACGT

CTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGG …

Castanopsis kawakamii voucher GN201 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor210

Museum / vouchered238

Origin

Native9

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 163

163 georeferenced · 47 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	38
Taipei, TW	30
Guangzhou, CN	21
Chengdu, CN	16
Guilin, CN	15
Kunming, CN	14
Nanjing, CN	14
SCAUlocation not on record	12
Bronx, US	10
TAIElocation not on record	9
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	6
Xiamen, CN	5
Nagasaki University - Fisherieslocation not on record	5
Jiangxi Agricultural Universitylocation not on record	5
Hangzhou, CN	4
Paris, FR	4
Zhuzhou, CN	3
Taipei, TW	3
Herbarium of South China Botanical Gardenlocation not on record	3
Yangling, CN	2
中国林业科学研究院热带林业科学研究所植物标本室location not on record	2
Cincinnati, US	2
Nanjing, CN	2
South China Normal Universitylocation not on record	2
Guangzhou, CN	2
Fujian Institute of Subtropical Botanylocation not on record	2
Taipei, TW	2
Saint Louis, US	1
Stockholm, SE	1
Guiyang, CN	1
Changsha, CN	1

31 institutions · 237 of 238 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Castanopsis kawakamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 17.5–24.6

Seasonal swing summer↔winter17.7 °C

Max temp (day)27.6 °C 20.3–28.4

Min temp (night)19.2 °C 13.3–20.0

Precipitation242 mm/mo 219–351

Air humidity67.4 % 64.2–69.8

Moisture balance84.5 mm/mo 52.3–244

Vapour deficit1,017 Pa 627–1,096

Wind speed3.70 m/s 3.70–3.90

Cloud cover50.9 % 50.6–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)