Castanopsis concinna — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Castanopsis

At a glance

Occurrence records50

Data sources8

Biological traits17

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Castanopsis concinna's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionDukesPhytochem1 compounds

Occurrence & distributionGBIF50 records

DNA & barcodingNCBIsequences

01Narrative

Castanopsis concinna is a species of plant in the family Fagaceae. It is a tree found in broad-leaved evergreen forests of southern Guangdong and Guangxi in China and in Hong Kong. It is under second-class national protection in China. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length55 mm

Fruit length max60 mm

Fruit length min50 mm

Plant height15 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation mean500 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Castanopsis concinna across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Documented compounds1 total

Compound	Class	Amount	Source
BETULIN		6 ppm	DukesPhytochem

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Castanopsis concinna has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_033409.1 ↗160 603 bpChina

ACGT

TCTTTTCTTTTTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCC …

Castanopsis concinna voucher Strijk_1489 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2

plant barcode

08Occurrence & distribution

Record type50 records

Wild obs. + sensor16

Museum / vouchered34

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 16

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	11
Bronx, US	10
Paris, FR	9
Beijing, CN	2
Guilin, CN	2

5 institutions · 34 of 34 vouchered records shown