Cassytha racemosa

Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cassytha

At a glance

Occurrence records765

Data sources6

Biological traits24

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Cassytha racemosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility765 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF765 records

DNA & barcodingNCBIsequences

01Narrative

Cassytha racemosa (common name - dodder laurel) is a parasitic perennial in the Lauraceae family. It is found in Western Australia. The species was first described in 1845 by Christian Gottfried Daniel Nees von Esenbeck from specimen 1623 found near the town of Fremantle growing on Melaleuca huegelii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Leaf length1.75 mm

Leaf width0.9 mm

Seed mass34.48 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timennnnnnnnnnnn

Life formholoparasite

Life spanperennial

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous

Leaf compoundnesssimple

Leaf shapeovate peltate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition7 compounds

Compounds documented for Cassytha racemosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols2

Flavones2

Pregnane steroids1

Ursane and Taraxastane triterpenoids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
1-[(3S,8R,9S,10R,13S,14S,15S,17S)-15-hydroxy-10,13-dimethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone	present	NPASS
2''-O-Galloylhyperin	present	NPASS
Apiumetrin	present	NPASS
Dotorioside II	present	NPASS
Hyperin	present	NPASS
Luteolin 7-glucoside	present	NPASS
SZSFIVNCXNRKJA-KDGNTIAASA-N	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassytha racemosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

matKAB574383.1 ↗850 bpAustralia

ACGT

CATTTTGATGAAGCAACAGATTCGTCCATACCATTGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGGAATGAATGGAAAAAACAG …

Cassytha racemosa chloroplast DNA, trnK-trnH intergenic spacer, matK gene for maturase, partial cds, specimen_voucher: TNS:G.Kokubugata7129

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

08Occurrence & distribution

Record type765 records

Wild obs. + sensor477

Museum / vouchered288

Origin

Native9

Range

Area of Occupancy AOO2 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 255≤1 km 194≤10 km 4>10 km 4

457 georeferenced · 20 without coordinates

Open the mapobservation + sensor477

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 71≤1 km 12≤10 km 89>10 km 3

175 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence288

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	224
Adelaide, AU	19
Museo Entomologico de Leonlocation not on record	9
Mount Annan, AU	8
Canberra, AU	7
Brisbane, AU	6
BGPAlocation not on record	6
Kew, GB	2
Armidale, AU	2
Palmerston, AU	2
Joondalup, AU	1
LDlocation not on record	1

12 institutions · 287 of 288 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)