Cassytha melantha

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cassytha

At a glance

Occurrence records6 452

Data sources11

Biological traits35

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Cassytha melantha's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 452 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF6 452 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassytha melantha is a parasitic vine. Common names include coarse dodder-laurel and large dodder-laurel. The fruits are about 10 - in diameter and are green, drying to black. These are edible and are harvested in the wild. The species occurs in the states of Western Australia, South Australia, Tasmania, Victoria and New South Wales in Australia. The name has sometimes been misapplied to Cassytha filiformis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology13

Fruit length12.5 mm

Fruit width12.5 mm

Leaf length1 mm

Leaf size95.03 mm²

Leaf width0.8 mm

Seed length0.5 mm

Seed mass73.03 mg

Seed mass max73.03 mg

Seed mass min73.03 mg

Seed volume77 mm³

Seed volume max77 mm³

Seed volume min77 mm³

Seed width0.5 mm

Life cycle & reproduction9

Dispersal typeanimal

Flowering timennnnnyyyyynn

Life formholoparasite

Life spanperennial

Lifespan years13 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous

Leaf compoundnesssimple

Leaf shapeovate triangular

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition8 compounds

Compounds documented for Cassytha melantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoflavones3

Aporphine alkaloids $ Isoquinoline alkaloids3

Pterocarpan1

Lupane triterpenoids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Maackiain	present	NPASS
(8R)-3-(6-methoxy-1,3-benzodioxol-5-yl)-8-prop-1-en-2-yl-8,9-dihydrofuro[2,3-h]chromen-4-one	present	NPASS
17-Methoxy-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1(22),2,4(8),9,16(23),17-hexaene	present	NPASS
Cassythicine	present	LOTUS
Cuneatin methyl ether	present	NPASS
Fujikinetin methyl ether	present	NPASS
Lupeol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassytha melantha has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP453371.1 ↗4 818 bp

ACGT

GCGGTGTCGGTGTCGCGGATTGGATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAG …

Cassytha melantha voucher AZ04 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type6 452 records

Wild obs. + sensor5 111

Museum / vouchered1 339

Other2

Origin

Native1 490

Range

Area of Occupancy AOO16 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2 916≤1 km 1 272≤10 km 548>10 km 88

4 824 georeferenced · 287 without coordinates

Open the mapobservation + sensor5 111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 296≤1 km 320≤10 km 522>10 km 71

1 209 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence1 339

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	519
Museo Entomologico de Leonlocation not on record	184
Kensington, AU	142
Canberra, AU	106
Mount Annan, AU	89
Hobart, AU	69
Brisbane, AU	14
Palmerston, AU	13
Armidale, AU	13
Kew, GB	8
NSW Dept of Planning, Industry and Environmentlocation not on record	8
QVMAGlocation not on record	6
BGPAlocation not on record	6
Parkville, AU	4
Stockholm, SE	4
Claremont, US	2
La Trobe Universitylocation not on record	2
GZUlocation not on record	2
EL PASO, US	2
Smithfield, AU	1
Cambridge University Herbariumlocation not on record	1
Edinburgh, GB	1
University of Alberta Museumslocation not on record	1
Auckland, NZ	1
MeiseBGlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
Wellington, NZ	1
Joondalup, AU	1
MAlocation not on record	1
Minia, EG	1

31 institutions · 1 205 of 1 339 vouchered records shown · 133 without an institution code

09Environmental DNA1 detections

Where the DNA of Cassytha melantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cassytha melantha

At a glance

Sources11 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile4 classes

Documented compounds8 total

At a glance

Record type6 452 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 452 records