Cassytha glabella

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cassytha

At a glance

Occurrence records14 134

Data sources8

Biological traits34

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Cassytha glabella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF14 134 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cassytha glabella R.Br. – gatunek rośliny z rodziny wawrzynowatych (Lauraceae). Występuje naturalnie w południowo-zachodniej i południowo-wschodniej Australii oraz na Tasmanii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology10

Fruit length5 mm

Leaf length0.45 mm

Leaf mass21 mg

Leaf mass per area138 g/m2

Leaf size122 mm²

Leaf width0.5 mm

Plant height1.8 m

Seed mass34.88 mg

⚠ sources differ — TRY: 34.88 mg · AusTraits: 22.21 mg · GIFT: 35.92 mg

Seed mass max41.73 mg

Seed mass min31.16 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyyyyyyyyy

Life formholoparasite

Life spanperennial

Lifespan years62.5 years

Pollination syndromeinsect

Reproductive maturity2.5 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous

Leaf compoundnesssimple

Leaf shapeovate triangular

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.19 mm²/mg

03Chemical composition7 compounds

Compounds documented for Cassytha glabella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aporphine alkaloids $ Isoquinoline alkaloids3

Oleanane triterpenoids3

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3R,4S,5S)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde	present	NPASS
(1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-10-[(2R,3R,4S,5S)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-hydroxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde	present	NPASS
(1S,2R,4S,5R,8R,10S,13R,14R,17S,18R,20S)-2-hydroxy-10-[(2R,3R,4S,5S)-4-hydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5,9,9,13,20-hexamethyl-24-oxahexacyclo[15.5.2.01,18.04,17.05,14.08,13]tetracosane-20-carbaldehyde	present	NPASS
17-Methoxy-5,7,19,21-tetraoxa-13-azahexacyclo[10.10.1.02,10.04,8.016,23.018,22]tricosa-1(22),2,4(8),9,16(23),17-hexaene	present	NPASS
Cassythicine	present	LOTUS
RHESJLAFCRCDGX-MQKYFQJDSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassytha glabella has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLON594172.1 ↗365 bpAustralia · 2016

ACGT

GGAGTTCCACCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGC …

Cassytha glabella voucher 600300228 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK9★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type14 134 records

Wild obs. + sensor13 635

Museum / vouchered470

Other29

Origin

Native22

Range

Area of Occupancy AOO21 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 11 081≤1 km 1 801≤10 km 316>10 km 53

13 251 georeferenced · 384 without coordinates

Open the mapobservation + sensor13 635

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 61≤1 km 113≤10 km 145>10 km 9

328 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence470

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	114
Adelaide, AU	83
Hobart, AU	57
Museo Entomologico de Leonlocation not on record	56
QVMAGlocation not on record	53
Canberra, AU	19
Mount Annan, AU	19
Armidale, AU	12
Kew, GB	11
Parkville, AU	6
Batemans Bay, AU	5
Joondalup, AU	5
John T. Waterhouse Herbariumlocation not on record	5
Palmerston, AU	5
Wollongong, AU	3
LDlocation not on record	2
GZUlocation not on record	2
Stockholm, SE	1
University of Stellenboschlocation not on record	1
Auckland, NZ	1
University of Alberta Museumslocation not on record	1
University of the Sunshine Coastlocation not on record	1
La Trobe Universitylocation not on record	1
Claremont, US	1
Brisbane, AU	1
Wellington, NZ	1
DPIlocation not on record	1

27 institutions · 467 of 470 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Cassytha glabella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter8.90 °C

Max temp (day)24.2 °C

Min temp (night)18.2 °C

Precipitation94.2 mm/mo

Air humidity58.4 %

Moisture balance-80.4 mm/mo

Vapour deficit1,033 Pa

Wind speed5.20 m/s

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cassytha glabella

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Compound class profile2 classes

Documented compounds7 total

At a glance

Record type14 134 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 134 records