Cassipourea malosana

(Baker) Alston · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Rhizophoraceae/Cassipourea

At a glance

Occurrence records529

Data sources11

Biological traits21

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Cassipourea malosana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF529 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Cassipourea malosana is a species of plant native to tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height32.5 m

⚠ sources differ — GIFT: 32.5 m · TRY: 25 m

Plant height max5 m

Plant height min12 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 700 m

Elevation min600 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density588 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Cassipourea malosana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols4

Flavan-3-ols2

Cinnamic acids and derivatives1

Proanthocyanins1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,5S,6R,13S,21R)-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.7.1.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaene-6,9,17,19,21-pentol	present	LOTUS
(1S,3R,4R,5R)-1,3,4-trihydroxy-5-[3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyloxy]cyclohexane-1-carboxylic acid	present	NPASS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxychromen-4-one	present	NPASS
2-[[5,7-dihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
afzelechin-3-O-alpha-Lrhamnopyranoside	present	LOTUS
Hyperin	present	NPASS
Quercetin	present	NPASS
Quercetin 3-rutinoside	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassipourea malosana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX572390.1 ↗523 bpSouth Africa · 2010

ACGT

AGTGTTGGATTTAAGGCTGGTGTTAAAGATTATAAATTGAATTATTATACTCCTGATTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Cassipourea malosana voucher Abbott9115 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa

plant barcode

08Occurrence & distribution

Record type529 records

Wild obs. + sensor66

Museum / vouchered459

Cultivated / captive4

Range

Area of Occupancy AOO1 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 30≤1 km 11≤10 km 3

44 georeferenced · 22 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 458 without coordinates

Open the institutions mapphysical evidence459

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	110
Durban, ZA	56
Kew, GB	50
Saint Louis, US	47
TAFORI-LSRClocation not on record	22
MeiseBGlocation not on record	18
Adam Mickiewicz University in Poznańlocation not on record	13
National Museums of Kenyalocation not on record	12
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	10
WAGlocation not on record	10
Plocation not on record	7
Arusha, TZ	7
Berlin, DE	5
Clocation not on record	5
Uppsala, SE	5
Haramaya Universitylocation not on record	4
Yaoundé, CM	4
Addis Ababa, ET	4
Instituto de Investigação Científica Tropicallocation not on record	3
EAlocation not on record	3
Njala Universitylocation not on record	2
Stockholm, SE	2
Bronx, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Cape Town, ZA	2
Mlocation not on record	1
Llocation not on record	1
University Grenoble Alpeslocation not on record	1
Southern Highlands Conservation Programmelocation not on record	1
CJBGlocation not on record	1
DSMlocation not on record	1
Botanic Gardenlocation not on record	1
Helsinki, FI	1
MAlocation not on record	1
Frankfurt am Main	1
Limbe Botanical & Zoological Gardenslocation not on record	1
Forestry Research Institute of Nigerialocation not on record	1
University of Hamburglocation not on record	1
University of Johannesburglocation not on record	1
Forest Herbarium Ibadan (FHI)location not on record	1

40 institutions · 420 of 459 vouchered records shown · 39 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cassipourea malosana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.6–22.2

Seasonal swing summer↔winter6.40 °C

Max temp (day)23.9 °C 23.5–24.3

Min temp (night)19.5 °C 19.3–19.6

Precipitation110 mm/mo 84.6–136

Air humidity64.3 % 62.3–66.4

Vapour deficit933 Pa 894–972

Cloud cover26.9 % 25.3–28.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)