Cassinopsis ilicifolia

(Hochst.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Icacinales/Icacinaceae/Cassinopsis

At a glance

Occurrence records175

Data sources6

Biological traits15

DNA specimens6

eDNA detections4

Sources6 archives

Databases and archives Cassinopsis ilicifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF175 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cassinopsis ilicifolia is a spined, straggling shrub or liane that is native to the moister regions of southern Africa. It is named ilicifolia due to the leaves with somewhat serrated leaf margins, which resemble those of the genus Ilex.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height3.5 m

Plant height max6 m

Plant height min1 m

Seed mass168 mg

Life cycle & reproduction2

Life formscrambling shrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max1 845 m

Elevation min305 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: climber

Woodinesswoody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinopsis ilicifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF265330.1 ↗526 bpSouth Africa · 2008

ACGT

AGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGT …

Cassinopsis ilicifolia voucher OM1892 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type175 records

Wild obs. + sensor153

Museum / vouchered22

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 82≤1 km 16≤10 km 6>10 km 1

105 georeferenced · 48 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	2
South African National Biodiversity Institutelocation not on record	2
University of Stellenboschlocation not on record	2
Guangzhou, CN	2
Museo Entomologico de Leonlocation not on record	1
University of Johannesburglocation not on record	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
Uppsala, SE	1

11 institutions · 15 of 22 vouchered records shown · 7 without an institution code

09Environmental DNA4 detections

Where the DNA of Cassinopsis ilicifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 14.6–17.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)21.2 °C 18.9–23.5

Min temp (night)10.3 °C 10.2–10.4

Precipitation64.9 mm/mo 40.8–89.1

Air humidity59.0 % 57.3–60.6

Moisture balance-52.2 mm/mo -66.8–-37.6

Vapour deficit743 Pa 657–829

Wind speed2.60 m/s 1.80–3.30

Cloud cover16.8 % 15.8–17.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)