Cassinia subtropica

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records433

Data sources9

Biological traits30

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Cassinia subtropica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS · NPASS103 compounds

Occurrence & distributionGBIF433 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Cassinia subtropica, commonly known as bushy rosemary, is a species of flowering plant in the family Asteraceae and is endemic to north-eastern Australia. It is shrub with woolly-hairy stems, lance-shaped to egg-shaped leaves and panicles of flower heads.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology14

Fruit length0.6 mm

Leaf length25 mm

Leaf length max30 mm

Leaf length min10 mm

Leaf width6.5 mm

Leaf width max7 mm

Leaf width min3 mm

Plant height3 m

Plant height max2 m

Seed length0.55 mm

Seed mass0.101 mg

Seed mass max0.1 mg

Seed mass min0.1 mg

Seed width0.5 mm

Life cycle & reproduction5

Dehiscenceindehiscent

Flowering timennnyyyyyynnn

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition103 compounds

Compounds documented for Cassinia subtropica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids23

Eudesmane sesquiterpenoids18

Caryophyllane sesquiterpenoids3

Norlabdane diterpenoids3

Labdane diterpenoids3

Documented compounds103 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-(5R,7S,10S)-cis-Selina-4(15),11-dien-5-ol	present	LOTUS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(+)-Pinoresinol	present	LOTUS
(-)-alpha-Bisabolol	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Caryophyllene	present	LOTUS
(-)-Isocaryophyllene	present	LOTUS
(-)-Sandaracopimaric acid	present	NPASS
(1aS,4aR,7R,7aS,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,5,6,7,7a,7b-octahydrocyclopropa[h]azulen-4a-ol	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia subtropica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes6

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ956639.1 ↗724 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGCA …

Cassinia subtropica isolate ASL413 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type433 records

Wild obs. + sensor224

Museum / vouchered185

Cultivated / captive1

Other23

Origin

Native17

Range

Area of Occupancy AOO880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 125≤1 km 23≤10 km 14>10 km 7

169 georeferenced · 55 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 49≤1 km 29≤10 km 48>10 km 28

154 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence185

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	81
Canberra, AU	26
Mount Annan, AU	17
Museo Entomologico de Leonlocation not on record	17
Smithfield, AU	13
Armidale, AU	11
James Cook Townsvillelocation not on record	6
Hobart, AU	3
Kew, GB	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Honolulu, US	1
Santa Barbara, US	1
Adelaide, AU	1
Palmerston, AU	1

15 institutions · 182 of 185 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cassinia subtropica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.5 °C

Min temp (night)15.6 °C

Precipitation128 mm/mo

Air humidity61.9 %

Moisture balance15.0 mm/mo

Vapour deficit865 Pa

Wind speed1.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)