Cassinia scabrida

Orchard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records115

Data sources7

Biological traits19

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Cassinia scabrida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cassinia scabrida commonly known as rough cassinia, is a species of flowering plant in the family Asteraceae and is endemic to forests with rocky granite outcrops in north-eastern Victoria, Australia. It is an erect shrub with hairy foliage, linear leaves, and large numbers of greenish-white heads of flowers arranged in dense corymbs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology6

Fruit length1.1 mm

Leaf length60 mm

Leaf width4.5 mm

Plant height2 m

Plant height max2 m

Seed mass0.047 mg

Life cycle & reproduction6

Dispersal typewind

Flowering timeyynnnnnnnnyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment5

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf shapelinear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia scabrida has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM244715.1 ↗618 bpAustralia

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCAGGCAACATAGGGATTGAGATTCTTCTTGATCCTTAGTTGCCTT …

Cassinia scabrida internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor46

Museum / vouchered68

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 9≤1 km 10≤10 km 21

40 georeferenced · 6 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 8≤1 km 27≤10 km 30

65 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence68

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	32
Canberra, AU	22
Hobart, AU	4
Mount Annan, AU	3
Adelaide, AU	2
Kew, GB	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Armidale, AU	1

8 institutions · 66 of 68 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cassinia scabrida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)