Cassinia monticola

Orchard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records405

Data sources7

Biological traits32

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Cassinia monticola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF405 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassinia monticola commonly known as mountain cassinia, is a species of flowering plant in the family Asteraceae and is endemic to mountain areas of south-eastern Australia. It is a spreading shrub with sticky, narrow linear to narrow lance-shaped leaves, and bronze-coloured to greenish-cream heads of flowers arranged in a dense, round-topped corymb.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology11

Fruit length1.4 mm

Leaf length22.5 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf width2.5 mm

Leaf width max4 mm

Leaf width min1 mm

Plant height0.75 m

Plant height max2 m

Plant height min0.3 m

Seed mass0.106 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typewind

Flowering endMar

Flowering startFeb

Flowering timenyynnnnnnnnn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate strap-shaped

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia monticola has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956633.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Cassinia monticola isolate ASL406 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type405 records

Wild obs. + sensor219

Museum / vouchered184

Cultivated / captive2

Origin

Native44

Range

Area of Occupancy AOO660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 150≤1 km 29≤10 km 10

189 georeferenced · 30 without coordinates

Open the mapobservation + sensor219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 30≤1 km 75≤10 km 45>10 km 8

158 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence184

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	67
Mount Annan, AU	44
Museo Entomologico de Leonlocation not on record	42
Armidale, AU	9
John T. Waterhouse Herbariumlocation not on record	7
Hobart, AU	6
Kew, GB	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Brisbane, AU	1
Adelaide, AU	1

10 institutions · 184 of 184 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia monticola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)