Cassinia longifolia

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records12 563

Data sources11

Biological traits35

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Cassinia longifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 563 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources35 traits

Chemical compositionLOTUS · NPASS40 compounds

Occurrence & distributionGBIF12 563 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Cassinia longifolia, commonly known as shiny cassinia, is a species of flowering plant in the family Asteraceae and is endemic to eastern Australia. It is an erect, aromatic shrub with sticky, hairy foliage, linear or oblong to narrow lance-shaped leaves, and heads of creamy-white flowers arranged in a dense corymb.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsWCVPGIFT

Size & morphology14

Fruit length0.9 mm

Leaf length80 mm

Leaf length max80 mm

Leaf length min40 mm

Leaf mass per area126 g/m2

Leaf size78.8 mm²

Leaf width5 mm

Leaf width max6 mm

Leaf width min2 mm

Petiole length0.075 cm

Plant height3 m

Plant height max3 m

Plant height min1.2 m

Seed mass0.058 mg

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyyyyynnnnnny

Life spanperennial

Lifespan years30 years

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate oblong

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition40 compounds

Compounds documented for Cassinia longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids6

Aromadendrane sesquiterpenoids6

Cadinane sesquiterpenoids5

Chalcones5

Flavonols4

Documented compounds40 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-gamma-Cadinene	present	LOTUS
(-)-Isocaryophyllene	present	LOTUS
(18\|A)-Oleanolic acid	present	LOTUS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(1aS,7R,7aS,7bS)-1,1,4,7-tetramethyl-1a,2,3,5,6,7,7a,7b-octahydrocyclopropa[e]azulene	present	LOTUS
(1R)-4,7-Dimethyl-1-(propan-2-yl)-1,2-dihydronaphthalene	present	LOTUS
(1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(1R,3aS,5aR,5bR,7aS,9S,11aR,11bR,13aR,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia longifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM244714.1 ↗614 bpAustralia

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGCAACATAGGGATTGAGCTTCTTCTGATCTTAGTTGCCTTTG …

Cassinia longifolia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type12 563 records

Wild obs. + sensor11 806

Museum / vouchered753

Cultivated / captive2

Other2

Origin

Native157

Introduced39

Range

Area of Occupancy AOO21 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 8 951≤1 km 1 845≤10 km 273>10 km 43

11 112 georeferenced · 694 without coordinates

Open the mapobservation + sensor11 806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 82≤1 km 228≤10 km 271>10 km 39

620 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence753

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	213
Museo Entomologico de Leonlocation not on record	208
Mount Annan, AU	155
Adelaide, AU	44
Hobart, AU	37
Armidale, AU	20
Brisbane, AU	14
Kew, GB	9
Batemans Bay, AU	9
Stockholm, SE	7
John T. Waterhouse Herbariumlocation not on record	6
Parkville, AU	5
Wollongong, AU	5
La Trobe Universitylocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	3
AUAlocation not on record	2
Auckland, NZ	2
Kensington, AU	1
GB	1
Christchurch, NZ	1
University of Stellenboschlocation not on record	1
Guangzhou, CN	1

22 institutions · 749 of 753 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Cassinia longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cassinia longifolia

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile5 classes

Documented compounds40 total

At a glance

Record type12 563 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type12 563 records