Cassinia leptocephala

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records150

Data sources8

Biological traits27

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Cassinia leptocephala's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF150 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassinia leptocephala is a species of flowering plant in the family Asteraceae and is endemic to New South Wales. It is a large, woody shrub with hairy, reddish stems, stiff linear leaves, and heads of pale yellow flowers arranged in a dense corymb.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology12

Fruit length0.6 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min50 mm

Leaf width1.75 mm

Leaf width max2.5 mm

Leaf width min1 mm

Plant height3 m

Plant height max3 m

Seed mass0.125 mg

⚠ sources differ — AusTraits: 0.125 mg · GIFT: 0.15 mg

Seed mass max0.15 mg

Seed mass min0.15 mg

Life cycle & reproduction4

Dehiscenceindehiscent

Flowering timeyynnnnnnyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Cassinia leptocephala across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Guaiane sesquiterpenoids3

Carabrane sesquiterpenoids1

Germacrane sesquiterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
8-Epiinuviscolide	present	LOTUS
Carabron	present	LOTUS
Inuviscolide	present	LOTUS
Pseudoivalin	present	LOTUS
Tomentosin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia leptocephala has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956629.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Cassinia leptocephala isolate ASL401 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor128

Museum / vouchered20

Cultivated / captive2

Origin

Native4

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 108≤10 km 6>10 km 1

115 georeferenced · 13 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 6≤10 km 2>10 km 3

15 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence20

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Hobart, AU	3
Armidale, AU	3
Brisbane, AU	1
Beijing, CN	1
Canberra, AU	1

8 institutions · 19 of 20 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia leptocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)