Cassinia laevis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records4 381

Data sources6

Biological traits37

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Cassinia laevis's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 381 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF4 381 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology12

Fruit length0.8 mm

Leaf length19.86 mm

Leaf length max50 mm

Leaf length min10 mm

Leaf mass2.3 mg

Leaf mass per area150 g/m2

Leaf size15.57 mm²

Leaf width0.927 mm

Leaf width max1 mm

Plant height2.7 m

Plant height max3 m

Seed mass0.084 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyyyyynnnyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry5

Leaf n16.84 mg/g

Leaf p1.04 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.21 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia laevis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956627.1 ↗723 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Cassinia laevis isolate ASL399 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type4 381 records

Wild obs. + sensor3 535

Museum / vouchered725

Cultivated / captive2

Other119

Origin

Native84

Range

Area of Occupancy AOO9 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 175≤1 km 114≤10 km 65>10 km 68

3 422 georeferenced · 113 without coordinates

Open the mapobservation + sensor3 535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 152≤1 km 253≤10 km 194>10 km 30

629 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence725

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	370
Canberra, AU	84
Mount Annan, AU	82
NSW Dept of Planning, Industry and Environmentlocation not on record	57
Armidale, AU	52
NSW Office of Environment and Heritagelocation not on record	18
Museo Entomologico de Leonlocation not on record	18
Kew, GB	10
Smithfield, AU	6
Wollongong, AU	4
Hobart, AU	4
Brisbane, AU	3
University of Stellenboschlocation not on record	3
Palmerston, AU	3
EL PASO, US	2
Albuquerque, US	1
Beijing, CN	1
John T. Waterhouse Herbariumlocation not on record	1
MeiseBGlocation not on record	1
AUAlocation not on record	1

20 institutions · 721 of 725 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia laevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cassinia laevis

At a glance

Sources6 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry5

At a glance

Record type4 381 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 381 records