Cassinia decipiens

Orchard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records90

Data sources7

Biological traits26

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Cassinia decipiens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility90 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF90 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassinia decipiens is a species of flowering plant in the family Asteraceae and is endemic central New South Wales. It is a shrub with woolly-hairy young twigs, spreading, cylindrical leaves, and heads of creamy-brown to yellowish flowers arranged in a rounded cyme.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology11

Fruit length0.8 mm

Leaf length15 mm

Leaf length max20 mm

Leaf length min10 mm

Leaf width0.9 mm

Leaf width max1 mm

Leaf width min0.8 mm

Plant height1.7 m

Plant height max1.9 m

Plant height min1.5 m

Seed mass0.093 mg

Life cycle & reproduction5

Dehiscenceindehiscent

Flowering endJan

Flowering startDec

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia decipiens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956622.1 ↗699 bp

ACGT

TACAAGGTTTCGTAGGTGAACTGCGGAAGGATCTTGTCGAACCCTGCAAAGCAGACGACCCGTGAACATGTAACTACTACCGGGCACTAG …

Cassinia decipiens isolate ASL394 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type90 records

Wild obs. + sensor60

Museum / vouchered29

Cultivated / captive1

Origin

Native10

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 58≤1 km 1≤10 km 1

60 georeferenced

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 6≤1 km 9≤10 km 8>10 km 2

25 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	9
Canberra, AU	9
Museo Entomologico de Leonlocation not on record	3
Adelaide, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Armidale, AU	2
Brisbane, AU	1

7 institutions · 29 of 29 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia decipiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)