Cassinia cunninghamii

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records579

Data sources7

Biological traits38

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Cassinia cunninghamii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources38 traits

Occurrence & distributionGBIF579 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassinia cunninghamii, commonly known as Cunninghams everlasting, is a plant native to central New South Wales in eastern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology16

Fruit length0.5 mm

Leaf length25 mm

Leaf length max30 mm

Leaf length min20 mm

Leaf mass2.5 mg

Leaf mass per area299 g/m2

Leaf size9 mm²

Leaf width0.95 mm

Leaf width max1.5 mm

Leaf width min1 mm

Plant height1.25 m

⚠ sources differ — AusTraits: 1.25 m · TRY: 1 m

Plant height max1.5 m

Plant height min1 m

Seed mass0.141 mg

⚠ sources differ — TRY: 0.141 mg · AusTraits: 0.148 mg · GIFT: 0.14 mg

Seed mass max0.14 mg

Seed mass min0.14 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering timennnnnyyyyyyn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.36 mm²/mg

Wood density760 mg/cm³

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956621.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGTC …

Cassinia cunninghamii isolate ASL393 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type579 records

Wild obs. + sensor485

Museum / vouchered88

Cultivated / captive6

Origin

Native36

Range

Area of Occupancy AOO1 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 438≤1 km 27≤10 km 9>10 km 9

483 georeferenced · 2 without coordinates

Open the mapobservation + sensor485

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 21≤1 km 12≤10 km 29>10 km 2

64 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence88

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 3 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	36
Museo Entomologico de Leonlocation not on record	14
Canberra, AU	12
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Kew, GB	4
Brisbane, AU	3
Wollongong, AU	2
Hobart, AU	2
John T. Waterhouse Herbariumlocation not on record	2
Adelaide, AU	2
Beijing, CN	1
AUAlocation not on record	1
Armidale, AU	1
Batemans Bay, AU	1

14 institutions · 85 of 88 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)