Cassinia compacta

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records265

Data sources7

Biological traits36

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Cassinia compacta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Occurrence & distributionGBIF265 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Cassinia compacta is a species of flowering plant in the family Asteraceae and is endemic to eastern Australia. It is a shrub with densely hairy stems, linear leaves and heads of yellow flowers arranged in dense corymbs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology17

Fruit length0.5 mm

Leaf length55 mm

Leaf length max70 mm

Leaf length min20 mm

Leaf mass per area21.21 g/m2

Leaf size358 mm²

⚠ sources differ — TRY: 358 mm² · AusTraits: 405 mm²

Leaf width4.5 mm

Leaf width max3 mm

Leaf width min1 mm

Plant height2.5 m

Plant height max3 m

Plant height min2 m

Seed length1 mm

Seed mass0.881 mg

⚠ sources differ — TRY: 0.881 mg · AusTraits: 0.489 mg · GIFT: 0.88 mg

Seed mass max0.88 mg

Seed mass min0.88 mg

Seed width0.5 mm

Life cycle & reproduction7

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life spanperennial

Reproductive maturity5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)45.63 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia compacta has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes6

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ956612.1 ↗727 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCCGGG …

Cassinia compacta isolate ASL368 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type265 records

Wild obs. + sensor141

Museum / vouchered120

Cultivated / captive2

Other2

Origin

Native22

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 106≤1 km 13≤10 km 4

123 georeferenced · 18 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 14≤1 km 19≤10 km 36>10 km 9

78 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence120

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	32
Mount Annan, AU	22
Canberra, AU	15
Museo Entomologico de Leonlocation not on record	14
Armidale, AU	13
Hobart, AU	7
Kew, GB	4
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Wollongong, AU	1
University of Stellenboschlocation not on record	1
Adelaide, AU	1
Smithfield, AU	1
Honolulu, US	1

13 institutions · 114 of 120 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cassinia compacta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)