Cassinia arcuata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records588

Data sources9

Biological traits36

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Cassinia arcuata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF588 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cassinia arcuata, commonly known as drooping cassinia, biddy bush, Chinese scrub, sifton bush and Chinese shrub, is a species of flowering plant in the family Asteraceae and is endemic to Australia. It is a shrub, sometimes a small tree with sessile, linear leaves, and heads of up to two hundred brownish flowers arranged in pyramid-shaped panicles. In New South Wales, the species is known as Cassinia sifton. In disturbed areas, C. arcuata can become weedy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology14

Fruit length0.9 mm

Leaf length5 mm

Leaf length max15 mm

Leaf length min4 mm

Leaf mass per area75.93 g/m2

Leaf size4.2 mm²

Leaf width0.6 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height2 m

Plant height max2 m

Seed mass0.071 mg

⚠ sources differ — TRY: 0.071 mg · AusTraits: 0.053 mg · GIFT: 0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyyyyynnnyyyy

Life spanperennial

Lifespan years20 years

⚠ sources differ — TRY: 20 years · AusTraits: 15 years

Pollination syndromeinsect

Reproductive maturity2.5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Cassinia arcuata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Germacrane sesquiterpenoids1

Flavanones1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(2S)-pinocembrin		present	LOTUS
Eupatolide		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia arcuata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956611.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCAGGC …

Cassinia arcuata isolate ASL367 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type588 records

Wild obs. + sensor280

Museum / vouchered306

Cultivated / captive2

Origin

Native179

Range

Area of Occupancy AOO1 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 36≤1 km 166≤10 km 41

243 georeferenced · 37 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 47≤1 km 103≤10 km 97>10 km 12

259 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence306

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	57
Canberra, AU	46
Hobart, AU	34
Museo Entomologico de Leonlocation not on record	33
Kensington, AU	29
Brisbane, AU	20
Mount Annan, AU	19
Armidale, AU	15
Wollongong, AU	8
Kew, GB	7
Parkville, AU	5
John T. Waterhouse Herbariumlocation not on record	2
Stockholm, SE	1
Moscow State Universitylocation not on record	1
IPA/SPlocation not on record	1
BISHlocation not on record	1
Honolulu, US	1
Minia, EG	1
Christchurch, NZ	1
Saint Louis, US	1
Guangzhou, CN	1
MeiseBGlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
EL PASO, US	1
Palmerston, AU	1

25 institutions · 288 of 306 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassinia arcuata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)