Cassinia aculeata

(Labill.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cassinia

At a glance

Occurrence records5 846

Data sources9

Biological traits49

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Cassinia aculeata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 846 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources49 traits

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF5 846 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cassinia aculeata là một loài thực vật có hoa trong họ Cúc. Loài này được (Labill.) A.Cunn. ex R.Br. mô tả khoa học đầu tiên năm 1817.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology17

Fruit length0.9 mm

⚠ sources differ — AusTraits: 0.9 mm · GIFT: 1 mm

Leaf length50 mm

Leaf length max50 mm

Leaf length min3 mm

Leaf mass per area79.37 g/m2

Leaf size12.4 mm²

⚠ sources differ — TRY: 12.4 mm² · AusTraits: 30.5 mm²

Leaf width2 mm

⚠ sources differ — AusTraits: 2 mm · GIFT: 1 mm

Leaf width max1 mm

Leaf width min1 mm

Plant height2.6 m

⚠ sources differ — AusTraits: 2.6 m · TRY: 3.6 m

Plant height max6 m

Plant height min0.5 m

Seed length0.8 mm

Seed mass0.069 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Seed width0.3 mm

Life cycle & reproduction14

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering endJan

Flowering startFeb

Flowering timeyyynnnnnnnny

Life spanperennial

Lifespan years40 years

⚠ sources differ — TRY: 40 years · AusTraits: 32.5 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry7

Leaf c546 mg/g

Leaf n18.98 mg/g

Leaf p1.22 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)18.81 mm²/mg

Wood density640 mg/cm³

03Chemical composition27 compounds

Compounds documented for Cassinia aculeata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides4

Eudesmane sesquiterpenoids3

Germacrane sesquiterpenoids3

Aromadendrane sesquiterpenoids2

Atisane diterpenoids2

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(1R,4S,5R,9S,10R,12S)-5,9-dimethyl-13-methylidenetetracyclo[10.2.2.01,10.04,9]hexadecane-5-carboxylic acid	present	LOTUS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	LOTUS
(2R,4aR,8aR)-1,2,3,4,4a,5,6,8a-Octahydro-4a,8-dimethyl-alpha-methylene-2-naphthaleneacetic acid	present	LOTUS
(3aR,4R,6E,10E,11aR)-4-(Acetyloxy)-3a,4,5,8,9,11a-hexahydro-6,10-dimethyl-3-methylenecyclodeca(b)furan-2(3H)-one	present	LOTUS
2-[(2R,4aR,8aR)-8-(hydroxymethyl)-4a-methyl-2,3,4,5,6,8a-hexahydro-1H-naphthalen-2-yl]prop-2-enoic acid	present	LOTUS
5-Fluorouracil	present	NPASS
[(1R,4S,5R,9S,10R,12S)-5,9-dimethyl-13-methylidene-5-tetracyclo[10.2.2.01,10.04,9]hexadecanyl]methyl acetate	present	LOTUS
[(3aR,4R,6Z,10Z,11aR)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] acetate	present	LOTUS
ATGWGHLJNFEABD-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassinia aculeata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJQ956598.1 ↗604 bp

ACGT

CTGCAAAGCAGAACGACCCGTGAACATGTAACTACTTCCGGGCAACATAGGGATTGAGATTCTTCTTGATCCTTAGTTGCCTTTGTCAAT …

Cassinia aculeata isolate ASL354 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 846 records

Wild obs. + sensor4 902

Museum / vouchered939

Cultivated / captive5

Origin

Native69

Range

Area of Occupancy AOO13 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 4 013≤1 km 411≤10 km 146>10 km 69

4 639 georeferenced · 263 without coordinates

Open the mapobservation + sensor4 902

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 83≤1 km 168≤10 km 450>10 km 65

766 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence939

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	321
Canberra, AU	283
Adelaide, AU	82
Mount Annan, AU	70
QVMAGlocation not on record	31
Brisbane, AU	29
Parkville, AU	24
Armidale, AU	19
John T. Waterhouse Herbariumlocation not on record	10
Wollongong, AU	8
Auckland, NZ	7
Batemans Bay, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	7
Stockholm, SE	5
Christchurch, NZ	5
Palmerston, AU	4
Wellington, NZ	4
Minia, EG	3
Smithfield, AU	3
Kew, GB	3
University of Stellenboschlocation not on record	2
La Trobe Universitylocation not on record	2
Honolulu, US	1
BISHlocation not on record	1
China Agricultural Universitylocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
Hobart, AU	1

27 institutions · 934 of 939 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cassinia aculeata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cassinia aculeata

At a glance

Sources9 archives

Size & morphology17

Life cycle & reproduction14

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Compound class profile5 classes

Documented compounds27 total

At a glance

Record type5 846 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type5 846 records