Cassine peragua

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Cassine

At a glance

Occurrence records579

Data sources8

Biological traits16

DNA specimens9

eDNA detections6

Sources8 archives

Databases and archives Cassine peragua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF579 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Cassine peragua là một loài thực vật có hoa trong họ Dây gối. Loài này được L. mô tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max11 m

Plant height min0.5 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 700 m

Elevation min10 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)13.89 mm²/mg

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassine peragua has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences7

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392155.1 ↗563 bp

ACGT

TGCAACCAGAACGACCCGCGAATCGGTTTAAACAGATGCGGACGGCGGTCCTCAGGGCCCGTCGACCCAAGTCCGAGACGATGGCCGTGG …

Cassine peragua subsp. peragua voucher Muasya & Zhigila 8055 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type579 records

Wild obs. + sensor536

Museum / vouchered43

Range

Area of Occupancy AOO984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 385≤1 km 53≤10 km 11>10 km 1

450 georeferenced · 86 without coordinates

Open the mapobservation + sensor536

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	22
Cape Town, ZA	3
Uniwersytet Jagiellońskilocation not on record	3
University of Johannesburglocation not on record	3
South Kensington, GB	3
Moscow State Universitylocation not on record	1
Pretoria, ZA	1
Kew, GB	1
MeiseBGlocation not on record	1

9 institutions · 38 of 43 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Cassine peragua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 18.2–20.3

Seasonal swing summer↔winter7.40 °C

Max temp (day)23.6 °C 21.7–23.8

Min temp (night)15.9 °C 14.7–17.1

Precipitation50.1 mm/mo 23.4–61.9

Air humidity59.9 % 59.7–62.5

Moisture balance-94.4 mm/mo -125–-45.5

Vapour deficit847 Pa 823–937

Wind speed3.50 m/s 3.00–4.60

Cloud cover18.4 % 12.7–21.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)