Cassia roxburghii

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cassia

At a glance

Occurrence records113

Data sources12

Biological traits12

DNA specimens11

eDNA detections8

Sources12 archives

Databases and archives Cassia roxburghii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF113 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Cassia roxburghii là một loài thực vật có hoa trong họ Đậu. Loài này được DC. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass211 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density1 280 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition31 compounds

Compounds documented for Cassia roxburghii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Colensane and Clerodane diterpenoids4

Anthraquinones and anthrones3

Stigmastane steroids3

Cholestane steroids $ Stigmastane steroids2

Phytane diterpenoids2

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Epiafzelechin	present	LOTUS
(1R,2R)-1,3,8-trihydroxy-2-methyl-1,2-dihydroanthracene-9,10-dione	present	LOTUS
(2E,6E,10E)-12-acetyloxy-6,10-dimethyl-2-(4-methylpent-3-enyl)dodeca-2,6,10-trienoic acid	present	NPASS
(6aR,7S,8R,10aS)-7-[(2R)-2-(furan-3-yl)-2-hydroxyethyl]-7,8-dimethyl-5,6,6a,8,9,10-hexahydrobenzo[h][1]benzofuran-3-one	present	NPASS
(6aR,7S,8R,10aS)-7-[2-(furan-3-yl)ethyl]-7,8-dimethyl-5,6,6a,8,9,10-hexahydrobenzo[h][1]benzofuran-3-one	present	NPASS
(6aR,7S,8S,9R,10aS)-7-[(2R)-2-(furan-3-yl)-2-hydroxyethyl]-9-hydroxy-7,8-dimethyl-5,6,6a,8,9,10-hexahydrobenzo[h][1]benzofuran-3-one	present	NPASS
1,5,8-trihydroxy-2-methyl-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyanthracene-9,10-dione	present	LOTUS
1-[(2R,3S)-5-hydroxy-3-methoxy-2-prop-1-en-2-yl-2,3-dihydro-1-benzofuran-6-yl]ethanone	present	NPASS
1-hydroxy-6,8-dimethoxy-2-methyl-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxyanthracene-9,10-dione	present	LOTUS
17-(5-ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassia roxburghii has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes3

GenBank sequences7

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX856435.1 ↗413 bp

ACGT

CCACCCGACCCCCCTGGGGCCGTTGCACGCGGAAGCCAGCGCCTCTTCGAGGCACGGGCGGAAGCGTGGCAGCGGGATAACCACAACCCC …

Cassia roxburghii isolate 362 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cassia roxburghii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records24–282n range27median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Pantulu, J.V. 1942, 1947, 1960a ; Atchison, E. 1951 ; Irwin, H.S. & Turner, B.L. 1960

CCDB · book-atlas-flowering-plants — Atchison 1951

2n 241×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sarkar, A.K. et al. 1973b

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Choudhary, P. & S. S. Choudhary. 1988. Karyotypic studies and trend of speciation in some species of Caesalpiniaceae. J. Cytol. Genet. 23: 183–189.

n 142×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sanjappa, M. & A. Dasgupta. 1981. In Chromosome number reports LXXI. Taxon 30: 508–509.

CCDB · book-ipcn75-78 — Sharma 1970

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, L. S. & S. W. H. Husaini. 1981. Cytomorphological investigations of some species of the genus Cassia L. in Nigeria. Bull. Mus. Natl. Hist. Nat., B, Adansonia 4: 461–472.

n 121×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA, U. CHATTERJEE, & R. DATTA. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.

n 131×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Choudhary, P. & S. S. Choudhary. 1989. Meiotic studies for determination of taxonomic relatedness in some taxa of the Caesalpiniaceae (Fabaceae). Kromosomo 54: 1787–1792.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type113 records

Wild obs. + sensor89

Museum / vouchered22

Other2

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 35≤1 km 11≤10 km 7>10 km 11

64 georeferenced · 25 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 7≤10 km 2

9 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	7
Pondicherry, IN	4
Sri Ramaswamy Memorial Universitylocation not on record	3
Tampa, US	2
Moscow State Universitylocation not on record	2
Wuzhou, CN	1
Bronx, US	1
Canadian Department of Agriculturelocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

9 institutions · 22 of 22 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Cassia roxburghii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.0–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 30.5–30.7

Min temp (night)19.3 °C 17.8–19.3

Precipitation109 mm/mo 41.6–109

Air humidity52.0 % 48.0–52.0

Moisture balance-17.8 mm/mo -73.4–-17.8

Vapour deficit1,616 Pa 1,572–1,616

Wind speed1.80 m/s 1.80–2.10

Cloud cover25.2 % 12.6–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)