Cassia marksiana

(F.M.Bailey) Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cassia

At a glance

Occurrence records334

Data sources7

Biological traits32

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Cassia marksiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF334 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cassia marksiana, or Marks cassia, is an Australian rainforest tree growing in far north eastern New South Wales and in south eastern Queensland. The common name is in honour of Dr. C. F. Marks, an early botanical collector. Other common names include cigar cassia, brush cassia, and native laburnum. The Brunswick River is considered the southernmost point of natural distribution. Its habitat is seaside and lowland subtropical rainforest, which is almost completely destroyed, with only small remnant patches remaining. Less than 100 trees are known to exist in the wild in some 20 locations. Consequently, it is listed as endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length300 mm

Fruit width15 mm

Leaf length90 mm

Leaf length max230 mm

Leaf length min150 mm

Leaf width17.5 mm

Leaf width max40 mm

Leaf width min15 mm

Plant height22.5 m

Plant height max20 m

Seed length7 mm

Seed mass75.16 mg

Seed mass max75.16 mg

Seed mass min75.16 mg

Seed width5 mm

Life cycle & reproduction6

Dehiscencedehiscent

Flowering timennnnnnnnyyyn

Life formtree

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume_indehiscent

⚠ sources differ — AusTraits: legume_indehiscent · GIFT: pod

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: shrub/tree

Leaf compoundnesscompound

Leaf shapelanceolate ovate

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassia marksiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895872.1 ↗553 bpAustralia

ACGT

AAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Cassia marksiana voucher 129308331 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type334 records

Wild obs. + sensor215

Museum / vouchered110

Cultivated / captive4

Other5

Origin

Native25

Introduced1

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 169≤1 km 13≤10 km 2>10 km 3

187 georeferenced · 28 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 47≤1 km 14≤10 km 16>10 km 12

89 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence110

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	43
Mount Annan, AU	26
NSW Dept of Planning, Industry and Environmentlocation not on record	20
Canberra, AU	8
Armidale, AU	5
Museo Entomologico de Leonlocation not on record	4
Hobart, AU	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

8 institutions · 108 of 110 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cassia marksiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 20.4–20.4

Seasonal swing summer↔winter7.90 °C

Max temp (day)22.3 °C

Min temp (night)18.6 °C

Precipitation136 mm/mo

Air humidity59.9 %

Vapour deficit964 Pa

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)