Cassia leptophylla

Vogel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cassia

At a glance

Occurrence records247

Data sources11

Biological traits19

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Cassia leptophylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF247 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Cassia leptophylla is a tropical tree species in the genus Cassia, which is indigenous to Brazil. It is named gold medallion tree and has yellow flowers that bloom intermittently throughout the year, spawning seedpods that are rectangular in cross section and rattle festively. It is recognized by its thin green foliage with glossy green pinnate leaflets. The fruit is a long thin seedpod with four sides.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height9 m

Plant height max18 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition50 compounds

Compounds documented for Cassia leptophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Pregnane steroids10

Piperidine alkaloids10

Steroidal alkaloids9

Pregnane steroids $ Steroidal alkaloids9

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Spectaline	present	LOTUS
(1S)-1-[(3R,8S,9S,10R,13S,14S,17S)-3-methoxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]-N,N-dimethylethanamine	present	NPASS
(2R,3R,6R)-6-[(11S)-11-hydroxydodecyl]-2-methylpiperidin-3-ol	present	LOTUS
(2R,3R,6S)-6-[(11S)-11-hydroxydodecyl]-2-methylpiperidin-3-ol	present	LOTUS
(2R,3R,6S)-6-[(13S)-13-hydroxytetradecyl]-2-methylpiperidin-3-ol	present	LOTUS
(2S)-12-[(2R,5S,6S)-5-hydroxy-6-methylpiperidin-2-yl]dodecane-1,2-diol	present	LOTUS
(3S,5S,8R,9S,10S,13R,17S)-17-[(1S)-1-(dimethylamino)ethyl]-N,10,13-trimethyl-2,3,4,5,6,7,8,9,11,12,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-amine	present	NPASS
(3S,5S,8R,9S,10S,13S,14S,17S)-17-[(1R)-1-(dimethylamino)ethyl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-amine	present	NPASS
(3S,5S,8R,9S,10S,13S,14S,17S)-17-[(1R)-1-(dimethylamino)ethyl]-N,N,10,13-tetramethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-amine	present	NPASS
(3S,8S,9S,10R,13S,14S,17S)-17-[(1R)-1-(dimethylamino)ethyl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassia leptophylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKU245651.1 ↗1 808 bp

ACGT

TATGTATCATTTGATAACCCAATAAATCCTCGATCCTTGGTCCCAATCGAATTTCAAAAATGGAGGAATTTCAGTATATTTAGAACTAGA …

Cassia leptophylla voucher Queiroz 12555 (HUEFS) tRNA-Lys (trnK) gene, intron; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cassia leptophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Biondo. 2005. Números cromosômicos e implicações sistemáticas em espécies da subfamília Caesalpinioideae (Leguminosae). Revista Brasil. Bot. 28(4): 797–808.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type247 records

Wild obs. + sensor35

Museum / vouchered211

Other1

Origin

Native64

Introduced4

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 22≤1 km 3≤10 km 3

28 georeferenced · 7 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 2≤1 km 3≤10 km 1>10 km 3

9 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	46
San Jose State University, Museum of Birds and Mammalslocation not on record	26
Porto Alegre, BR	15
Auckland, NZ	11
Ivano-Frankivsk, UA	10
Istituto Agrario Castelnuovolocation not on record	8
Blumenau, BR	8
UNESClocation not on record	8
Chicago, US	7
Criciúma, BR	6
Cascavel, BR	5
Museo Entomologico de Leonlocation not on record	4
UTFPR-CPlocation not on record	4
UEMlocation not on record	4
Foz do Iguaçu, BR	4
Maringá, BR	3
Laboratorio de Ictiologialocation not on record	3
USP-IBlocation not on record	3
Rotorua, NZ	2
UnBlocation not on record	2
Universidad Nacional Federico Villarreallocation not on record	2
UTFPR-DVlocation not on record	2
Lake Charles, US	2
UNESP-RClocation not on record	2
Feira de Santana, BR	2
PUC-RSlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Campo Mourão, BR	1
JBRJlocation not on record	1
Christchurch, NZ	1
UFPRlocation not on record	1
UEPAlocation not on record	1
Universidade Federal do Maranhãolocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
UFSCarlocation not on record	1
IAPlocation not on record	1
Tampa, US	1
UFMGlocation not on record	1
Brasília, BR	1
Université de Bordeauxlocation not on record	1
Chaguaramas, TT	1
Riverside, US	1
Pelotas, BR	1
Universidade Federale do Rio Grande do Sullocation not on record	1

44 institutions · 210 of 211 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)