Cassia javanica
speciesAt a glance
Occurrence records609
Data sources13
Biological traits23
DNA specimens9
eDNA detections17
Sources13 archives
Databases and archives Cassia javanica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility609 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources23 traits
Chemical compositionLOTUS · NPASS120 compounds
Occurrence & distributionGBIF609 records
Environmental DNA1 datasets · 3 countries17 detections
DNA & barcodingBOLD · NCBI9 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Le casse de Java est une espèce de plantes à fleurs de la famille des Fabaceae. C'est un arbre originaire d'Asie du Sud-Est.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Plant height15 m
⚠ sources differ — GIFT: 15 m · TRY: 20 m
Plant height max25 m
Seed mass261 mg
⚠ sources differ — TRY: 261 mg · GIFT: 204 mg
Seed mass max476 mg
Seed mass min131 mg
Life cycle & reproduction5
Deciduousnessdeciduous
Dispersal type detailedanthropochorous
Life formtree
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max1 000 m
Elevation min100 m
Epiphyteterrestrial
Growth formtree
Succulenceno
Woodinesswoody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Wood density643 mg/cm³
03Chemical composition120 compounds
Compounds documented for Cassia javanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Anthraquinones and anthrones12
Unsaturated fatty acids10
Lupane triterpenoids9
Flavonols8
Oleanane triterpenoids8
Documented compounds120 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Betulonic acid | present | NPASS | |
| (-)-beta-Phellandrene | present | NPASS | |
| (-)-Epiafzelechin | present | LOTUS | |
| (-)-Epiafzelechin-(4beta-8)-(-)-epicatechin | present | LOTUS | |
| (14S,15R,19R)-14-[(10R,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | NPASS | |
| (14S,15S,19S)-14-[(10S,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | NPASS | |
| (1R,3aR,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol | present | NPASS | |
| (1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone | present | NPASS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-8-[(2S,3S,4S)-3,5,7-trihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol | present | LOTUS |
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cassia javanica has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes3
GenBank sequences10
eDNA detections17
Countries3
The DNA barcodea real sequence read deposited for this species
TTTGGATTTTAACAGGCTTCACAAATGTGTCCATAGGAAAGCGTGCGCATGGCTCTTCCTGGATGCCTCAACACAAAACAAACACGCCAA …
Cassia javanica subsp. nodosa isolate MD7 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★ITS6
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cassia javanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records24–282n range28median28mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 287×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · eflora +1
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1982. Karyotypic studies in Cassia Linn. from India. Proc. Indian Acad. Sci. 48: 397–404.
CCDB · ipcn-api-dl — George, S. M. & K. V. Bhavanandan. 1993. Cytological studies in some species of Cassia from south India. J. Cytol. Genet. 28: 1–5.
CCDB · book-indian_vol1 — Jacob, K.T. 1940 ; Ramanathan, K. 1950 ; Atchison, E. 1951 ; Irwin, H.S. & Turner, B.L. 1960 ; Bir, S.S. & Sidhu, S. 1966, 1967 ; Tandon, S.L. & Bhat, R.N. 1971 ; Bir, S.S. & Kumari, S. 1980
CCDB · book-indian_vol1 — Banerjee, S.K. & Banda, G.K. 1967 ; Chatterjee, P. 1969 ; Mehra, P.N. & Hans, A.S. 1969, 1971, 1972 ; Tan don, S.L. & Bhat, R.N. 1970. 1971 .
CCDB · eflora
CCDB · book-atlas-flowering-plants — Ramanathan 1950
2n 242×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants
CCDB · book-indian_vol1 — Atchison, E. 1951 ; Irwin, H.S. & Turner, B.L. 1960
CCDB · book-atlas-flowering-plants — ShMW Trop. Asia
n 1413×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn72 +3
CCDB · ipcn-api-dl — George, S. M. & K. V. Bhavanandan. 1993. Cytological studies in some species of Cassia from south India. J. Cytol. Genet. 28: 1–5.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1979. Cytological evolution of the leguminous flora of the Punjab plain. Recent Res. Pl. Sci. (New Delhi). 7: 252–260.
CCDB · ipcn-api-dl — Gill, L. S. & S. W. H. Husaini. 1981. Cytomorphological investigations of some species of the genus Cassia L. in Nigeria. Bull. Mus. Natl. Hist. Nat., B, Adansonia 4: 461–472.
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · book-ipcn66 — Bir & Sidhu 1966
CCDB · book-ipcn72 — MEHRA, P.N., & A.S. HANS. 1971. Cytological observations on arborescent Leguminosae of eastern Himalayas. Nucleus 14: 144-152.
CCDB · book-ipcn67-71 — TANDON, S.L., & R.N. BHAT. 1970. In IOPB chromosome number reports XXV. Taxon 19: 102-113.
CCDB · book-ipcn67-71 — BIR, S.S. & S. SIDHU. 1967. Cytological observations on the North Indian members of family Leguminosae. Nucleus 10: 47-63.
CCDB · book-ipcn67-71 — MEHRA, P.N., & A.S. HANS. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.
CCDB · book-ipcn75-78 — Mehra 1976
CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.
n 122×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type609 records
Wild obs. + sensor270
Museum / vouchered319
Cultivated / captive1
Other19
Origin
Native1
Introduced5
Range
Area of Occupancy AOO1 544 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy75% within 1 km
≤100 m 91≤1 km 45≤10 km 19>10 km 26
181 georeferenced · 89 without coordinates
Open the mapobservation + sensor270
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy74% within 1 km
≤100 m 20≤1 km 31≤10 km 15>10 km 3
69 georeferenced · 250 without coordinates
Open the institutions mapphysical evidence319
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions40 of 81 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Canberra, AU | 22 |
| Saint Louis, US | 22 |
| Smithfield, AU | 12 |
| Brisbane, AU | 12 |
| Kew, GB | 10 |
| Durango, MX | 9 |
| Xiamen, CN | 7 |
| Ilhéus, BR | 6 |
| St. Augustine, TT | 6 |
| Mérida, MX | 6 |
| Mexico City, MX | 6 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Salvador, BR | 5 |
| Ivano-Frankivsk, UA | 5 |
| LBVlocation not on record | 4 |
| Paris, FR | 4 |
| Departamento de Sistematica e Ecologialocation not on record | 4 |
| Tampa, US | 4 |
| Bronx, US | 4 |
| Yaoundé, CM | 4 |
| CNF-UFHBlocation not on record | 4 |
| UFRPElocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| USP-IBlocation not on record | 3 |
| Herbier National du Gabonlocation not on record | 3 |
| WAGlocation not on record | 3 |
| Taipei, TW | 3 |
| Baroda, IN | 3 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Palmerston, AU | 2 |
| Tapachula, MX | 2 |
| Pretoria, ZA | 2 |
| CEPLAClocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Brasília, BR | 2 |
| Blumenau, BR | 2 |
| ASUlocation not on record | 2 |
| Bloomington, US | 2 |
| MAlocation not on record | 2 |
| Taipei, TW | 2 |
| JBRJlocation not on record | 2 |
| Porto Alegre, BR | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| CJBGlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Mexico City, MX | 1 |
| Criciúma, BR | 1 |
| Feira de Santana, BR | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Glocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Pondicherry, IN | 1 |
| San Francisco, US | 1 |
| UNESClocation not on record | 1 |
| Berlin, DE | 1 |
| Gump Stationlocation not on record | 1 |
| Chicago, US | 1 |
| Managua, NI | 1 |
| University of Hamburglocation not on record | 1 |
| LDlocation not on record | 1 |
| Yangling, CN | 1 |
| Uberlândia, BR | 1 |
| Universidad del Valle (UniValle)location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| EAlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Guangzhou, CN | 1 |
| UNESP-FCAlocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| UnBlocation not on record | 1 |
| UEMlocation not on record | 1 |
| LGlocation not on record | 1 |
| Vancouver, CA | 1 |
81 institutions · 253 of 319 vouchered records shown · 66 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Cassia javanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.1 °C 10.5–23.4
Seasonal swing summer↔winter13.4 °C
Max temp (day)22.5 °C 15.9–28.8
Min temp (night)12.8 °C 6.50–20.1
Precipitation2.20 mm/mo 0.4–11.3
Air humidity56.3 % 47.1–64.4
Moisture balance-37.0 mm/mo
Vapour deficit885 Pa 558–1,385
Wind speed2.90 m/s
Cloud cover21.4 % 10.7–30.4
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.