Casearia gladiiformis

Mast. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Casearia

At a glance

Occurrence records170

Data sources8

Biological traits17

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Casearia gladiiformis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF170 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Casearia gladiiformis, the sword-leaf, is a small tree that occurs mostly in dry coastal forests of south-eastern Africa. It is distributed from the Eastern Cape to Malawi. It bears small inconspicuous flowers in spring. The seeds are released when the woody seed capsule splits open after drying out.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 8 m

Plant height max24.37 m

Plant height min2.27 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 675 m

Elevation min30 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Casearia gladiiformis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFR990827.1 ↗723 bpMozambique · 1980

ACGT

CCAGTGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGGAACCCTGCCCCGCAGAACGACCCGCGA …

Casearia gladiiformis 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial) isolate SAL148

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type170 records

Wild obs. + sensor18

Museum / vouchered152

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 10≤1 km 5≤10 km 2

17 georeferenced · 1 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 150 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	65
Durban, ZA	37
Kew, GB	12
Instituto de Investigação Científica Tropicallocation not on record	10
Saint Louis, US	5
University of Johannesburglocation not on record	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
MeiseBGlocation not on record	2
EAlocation not on record	2
Arusha, TZ	2
CJBGlocation not on record	1
MAlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
UJlocation not on record	1

15 institutions · 144 of 152 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Casearia gladiiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 20.4–25.5

Seasonal swing summer↔winter6.70 °C

Max temp (day)27.6 °C 25.4–29.7

Min temp (night)18.9 °C 16.1–21.7

Precipitation108 mm/mo 44.1–171

Air humidity63.7 % 62.6–64.8

Moisture balance-3.90 mm/mo -41.0–33.2

Vapour deficit1,029 Pa 900–1,158

Wind speed1.80 m/s

Cloud cover38.9 % 19.1–58.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)