Casearia crassinervis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Casearia

At a glance

Occurrence records18

Data sources5

Biological traits6

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Casearia crassinervis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility18 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF18 records

DNA & barcodingNCBIsequences

01Narrative

Casearia crassinervis is a species of plant in the Salicaceae family. It is endemic to Cuba.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Casearia crassinervis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFR990787.1 ↗690 bpCuba · 2012

ACGT

TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCCCCGCAGAACGACCCGCGAACTAGTTTTGCCATCGC …

Casearia crassinervis 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial) isolate SAL015

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor3

Museum / vouchered15

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	3
Montréal, CA	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Bronx, US	1
Kew, GB	1
Saint Louis, US	1
Frankfurt am Main	1

7 institutions · 11 of 15 vouchered records shown · 4 without an institution code