Casasia clusiifolia

(Jacq.) Urb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Casasia

At a glance

Occurrence records969

Data sources8

Biological traits14

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Casasia clusiifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility969 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF969 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Casasia clusiifolia, also called the sevenyear apple, is a species of plant belonging to the family Rubiaceae. It is common in Florida.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height3.96 m

Seed mass37.48 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Casasia clusiifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF493433.1 ↗611 bp

ACGT

TCGAATCCTGCAAAGCAGACGACCGCGAACTCGTGTTAACCGCCGGGCGACGGGAGAGGGGCGGCGAGGCCTCGCCCTCCCCTCCTTTCC …

Casasia clusiifolia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type969 records

Wild obs. + sensor874

Museum / vouchered95

Range

Area of Occupancy AOO1 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 602≤1 km 92≤10 km 31>10 km 23

748 georeferenced · 126 without coordinates

Open the mapobservation + sensor874

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 4≤10 km 13>10 km 1

18 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	12
Jena Microbial Resource Collectionlocation not on record	9
Bronx, US	6
Bangkok, TH	5
Saint Louis, US	4
Bloomington, US	4
Wuzhou, CN	3
Berlin, DE	3
Kew, GB	2
University of Stellenboschlocation not on record	2
Honolulu, US	2
BISHlocation not on record	2
Stockholm, SE	1
US	1
University of North Carolina at Pembrokelocation not on record	1
Durham, US	1
Dekalb, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Burlington, US	1
Istituto Agrario Castelnuovolocation not on record	1
LDlocation not on record	1
Santa Barbara, US	1
ASUlocation not on record	1

23 institutions · 65 of 95 vouchered records shown · 30 without an institution code

09Environmental DNA3 detections

Where the DNA of Casasia clusiifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)