Caryota obtusa

Griff. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Caryota

At a glance

Occurrence records57

Data sources8

Biological traits25

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Caryota obtusa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Caryota obtusa is a species of flowering plant in the palm family from India, Laos and Thailand. The palm is commonly called giant fishtail palm or Thai giant caryota. It can reach 20 meters or more in height and is thus considered a tree. It is monocarpic meaning it flowers once, then dies. Its inflorescence can reach 6 meters or more in length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length32 mm

Fruit length max35 mm

Fruit length min29 mm

Fruit width22.5 mm

Fruit width max25 mm

Fruit width min20 mm

Leaf length max6 000 mm

Plant height40 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourorange

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max90 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max4 000 cm

Shoot orientationerect

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caryota obtusa has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK692475.1 ↗488 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGGGGCCATCCGGTCCAGGGCACGCCTGCCTGAGCGTCAATT …

Caryota obtusa voucher XMBG087 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor34

Museum / vouchered23

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 9≤1 km 3>10 km 8

20 georeferenced · 14 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	8
Xiamen, CN	5
Bronx, US	5
Rotorua, NZ	2
EL PASO, US	1
CASlocation not on record	1
Berlin, DE	1

7 institutions · 23 of 23 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Caryota obtusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)