Caryocar brasiliense

A.St.-Hil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Caryocaraceae/Caryocar

At a glance

Occurrence records817

Data sources11

Biological traits23

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Caryocar brasiliense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility817 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF817 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT · NCBI≈212 Mbp

01Narrative

Le Péqui est une espèce de plantes à fleurs de la famille des Caryocaraceae. C'est un arbre du Brésil. C'est un grand arbre, avec un tronc de 2 à 5 mètres de circonférence et une hauteur de 15 à 20 mètres. Il se trouve le plus souvent dans les États brésiliens de Minas Gerais, Goiás, Tocantins et dans le District fédéral. Le fruit du Pequi est formé de graines rondes et oléagineuses, qui sont entourées par une pulpe. Sa peau est formée par une fine couche d'épines et, en son centre, il contient une amande huileuse de couleur blanche.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 3.51 m

Plant height max10 m

Life cycle & reproduction4

DeciduousnessBriefly deciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTCerrado (lato sensu)

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry6

Leaf n13.29 mg/g

Leaf p0.739 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.47 mm²/mg

Wood density488 mg/cm³

03Chemical composition1 compounds

Compounds documented for Caryocar brasiliense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile1 class

Wax monoesters1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Butyl palmitate		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caryocar brasiliense has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH432150.1 ↗687 bp

ACGT

GAACCTGCGGAAGGATCATTGTCGAAACCTGCTGACGCAGCACGACCCGCGAACGAGTTCCCACTCAATCTTCCGGCGCACCGGGGGCAC …

Caryocar brasiliense isolate Cb208 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Caryocar brasiliense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈212 172 521 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Caryocar brasiliense0.21 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Chromosome records46–462n range46median46mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 462×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ehrendorfer, F., W. Morawetz & J. Dawe. 1984. The neotropical angiosperm families Brunelliaceae and Caryocaraceae: first karyosystematical data and affinities. Pl. Syst. Evol. 145: 183–191.

CCDB · ipcn-api-dl — Maglio, C. A. F. P., E. R. Forni-Martins & N. D. d. Cruz. 1984. Chromosome Number Reports LXXXIV. Taxon 33: 536–539.

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness78.3% BUSCO

08Occurrence & distribution

Record type817 records

Wild obs. + sensor681

Museum / vouchered64

Other72

Origin

Native10

Range

Area of Occupancy AOO1 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 371≤1 km 87≤10 km 31>10 km 22

511 georeferenced · 170 without coordinates

Open the mapobservation + sensor681

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 64 records without

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	28
Bronx, US	9
CEPLAClocation not on record	6
FUNEDlocation not on record	5
UNESP-FCAlocation not on record	4
UNISANTAlocation not on record	3
Maringá, BR	3
Cuiabá, BR	1
UFPElocation not on record	1
Ilhéus, BR	1
Universidade Federale do Rio Grande do Sullocation not on record	1
UNESP-RClocation not on record	1

12 institutions · 63 of 64 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Caryocar brasiliense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)