Carya tonkinensis

Lecomte · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Juglandaceae/Carya

At a glance

Occurrence records24

Data sources9

Biological traits13

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Carya tonkinensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionNPASS15 compounds

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Carya tonkinensis, the Vietnam hickory, is a species of flowering plant in the genus Carya native to Assam in India, southern China, and northern Indochina. Local people harvest the wood for timber and furniture making, and collect the edible nuts for vegetable oil production.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height20 m

⚠ sources differ — GIFT: 20 m · TRY: 15 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Lifespan years1 300 years

Habitat & environment6

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min1 300 m

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition15 compounds

Compounds documented for Carya tonkinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Gallotannins10

Glutinane triterpenoids1

Flavonols1

Ursane and Taraxastane triterpenoids1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4aR,6aS,6bR,8aR,11R,12S,12aR,14bS)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a-dodecahydro-1H-picen-3-ol	present	NPASS
1,3,6-Tri-O-Galloyl-Beta-D-Glucose	present	NPASS
2-[(4R,5S,7R,18S,19S,20S,23S,24R,27S,28S,29S)-20-(carboxymethyl)-13,14,18,29,33,34-hexahydroxy-2,10,17,21,26,30-hexaoxo-5-(3,4,5-trihydroxybenzoyl)oxy-3,6,9,16,22,25,31-heptaoxaheptacyclo[26.7.1.111,15.04,23.07,24.032,36.019,37]heptatriaconta-1(35),11,13,15(37),32(36),33-hexaen-27-yl]acetic acid	present	NPASS
3,4,6-tri-O-galloyl-beta-d-glucose	present	NPASS
[(2S,3R,4S,5R,6R)-2,4,5-tris[(3,4,5-trihydroxybenzoyl)oxy]-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-3-yl] 2-[[(1S,19R,21S,22R,23R)-6,7,8,11,12,22,23-heptahydroxy-3,16-dioxo-21-(3,4,5-trihydroxybenzoyl)oxy-2,17,20-trioxatetracyclo[17.3.1.04,9.010,15]tricosa-4,6,8,10,12,14-hexaen-13-yl]oxy]-3,4,5-trihydroxybenzoate	present	NPASS
[(2S,3R,4S,5R,6R)-2,4,5-tris[(3,4,5-trihydroxybenzoyl)oxy]-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-3-yl] 2-[[(1S,19R,21S,22R,23R)-6,7,8,11,13,22,23-heptahydroxy-3,16-dioxo-21-(3,4,5-trihydroxybenzoyl)oxy-2,17,20-trioxatetracyclo[17.3.1.04,9.010,15]tricosa-4,6,8,10,12,14-hexaen-12-yl]oxy]-3,4,5-trihydroxybenzoate	present	NPASS
[(2S,3R,4S,5R,6R)-2,4,5-tris[(3,4,5-trihydroxybenzoyl)oxy]-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-3-yl] 2-[[(1S,19R,21S,22R,23R)-6,7,8,12,13,22,23-heptahydroxy-3,16-dioxo-21-(3,4,5-trihydroxybenzoyl)oxy-2,17,20-trioxatetracyclo[17.3.1.04,9.010,15]tricosa-4,6,8,10,12,14-hexaen-11-yl]oxy]-3,4,5-trihydroxybenzoate	present	NPASS
[(2S,3R,4S,5R,6R)-2,4,5-tris[(3,4,5-trihydroxybenzoyl)oxy]-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-3-yl] 2-[[(4R,5S,7R,25S,26R,30S,31R)-31-(1,1-dihydroxy-2-oxobut-3-enyl)-14,15,18,19,20,31,34,35-octahydroxy-2,10,23,28-tetraoxo-5-(3,4,5-trihydroxybenzoyl)oxy-3,6,9,24,27,32-hexaoxaheptacyclo[28.6.1.04,25.07,26.011,16.017,22.033,37]heptatriaconta-1(36),11,13,15,17,19,21,33(37),34-nonaen-13-yl]oxy]-3,4,5-trihydroxybenzoate	present	NPASS
[(2S,3R,4S,5S,6R)-2-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxo-chromen-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)tetrahydropyran-3-yl] 3,4,5-trihydroxybenzoate	present	NPASS
Chebulagic Acid	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carya tonkinensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF201316.1 ↗631 bp

ACGT

GATACCTGCCCAGCAGAACGACCCGTGAACTCGTAACAGCCTTCTGGGTTGGGGTGTCATGCCCCCTCCCAAAAACGGTTGGGAGGGCAC …

Carya tonkinensis voucher XXG314 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL7★ITS3★ITS2

plant barcodefungal barcode

07Deep time~4.08 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.08 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type24 records

Wild obs. + sensor2

Museum / vouchered21

Other1

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	6
Kunming, CN	5
Southwest Forestry Collegelocation not on record	2
Guilin, CN	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Guangzhou, CN	1
Chengdu, CN	1
Saint Louis, US	1

8 institutions · 19 of 21 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Carya tonkinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)