Carya myristiciformis

(F.Michx.) Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Juglandaceae/Carya

At a glance

Occurrence records327

Data sources10

Biological traits96

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Carya myristiciformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility327 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources96 traits

Occurrence & distributionGBIF327 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Carya myristiciformis, the nutmeg hickory, a tree of the Juglandaceae or walnut family, also called swamp hickory or bitter water hickory, is found as small, possibly relict populations across the Southern United States and in northern Mexico on rich moist soils of higher bottom lands and stream banks. Little is known of the growth rate of nutmeg hickory. Logs and lumber are sold mixed with other hickories. The nuts are an oil-rich food for wildlife.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height32.02 m

⚠ sources differ — GIFT: 32.02 m · USDA: 28.96 m · TRY: 28.96 m

Seed mass3 667 mg

Seed mass max3 704 mg

Seed mass min3 658 mg

Life cycle & reproduction25

Bloom periodMid Spring

Coppice potentialNo

Deciduousnessdeciduous

Dispersal typeanimal

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formtree

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorHigh

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formtree

Growth form USDASingle Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min48 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry20

Anaerobic toleranceLow

C:N ratioHigh

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceLow

Fertility requirementMedium

Fire resistantNo

Fire toleranceLow

Frost free days min240 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min40 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max6.5 pH

Soil pH min4.7 pH

Temperature min-10 °F

Wood density560 mg/cm³

Uses & economy15

Berry nut seed productYes

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Fuelwood productHigh

Lumber productYes

Naval store productYes

Nursery stock productNo

Palatable browse animalLow

Palatable humanYes

Post productNo

Pulpwood productYes

Seeds per pound124 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousYes

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceNo

Height at 20yr9.14 m

Planting density max700 per acre

Planting density min300 per acre

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carya myristiciformis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF201309.1 ↗643 bp

ACGT

GATACCTGCCCAGCAGAACGACCCGTGAACTTGTAATAACCTTCTGGGTTGGGGTGTCATGCCCCCTCCCGAAAACGGTTGGGAGGGCAC …

Carya myristiciformis voucher XXGZ-17 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carya myristiciformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type327 records

Wild obs. + sensor96

Museum / vouchered219

Other12

Range

Area of Occupancy AOO820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 51≤1 km 5≤10 km 3>10 km 25

84 georeferenced · 12 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 40≤1 km 17≤10 km 30>10 km 7

94 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	42
Jackson, US	24
Austin, US	21
University of Stellenboschlocation not on record	18
Tuscaloosa, US	14
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	13
Wuzhou, CN	12
Mississippi State, US	11
Fort Worth, US	8
Fayetteville, US	6
Little Rock, US	5
BAYLUlocation not on record	5
US	4
GAlocation not on record	4
Edmonton, CA	4
Chapel Hill, US	3
Saint Louis, US	3
Giardini Botanici Hanburylocation not on record	2
Jena Microbial Resource Collectionlocation not on record	2
Burlington, US	2
Bangkok, TH	2
Riverside, US	1
Mexico City, MX	1
Mexico City, MX	1
Phoenix, US	1
Torreón, MX	1
EL PASO, US	1
Linares, MX	1
Alicante, ES	1
Claremont, US	1
Columbia, US	1
AUAlocation not on record	1
Tall Timbers Research Stationlocation not on record	1
GB	1

34 institutions · 218 of 219 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Carya myristiciformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)