Carum carvi
speciesAt a glance
Occurrence records123 374
Data sources17
Biological traits51
DNA specimens49
eDNA detections26
Sources17 archives
Databases and archives Carum carvi's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility123 374 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics49 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources51 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 016 compounds
Occurrence & distributionGBIF123 374 records
Environmental DNA2 datasets · 9 countries26 detections
DNA & barcodingBOLD · NCBI49 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Lagoecia, wild cumin, is a genus of flowering plants in the family Apiaceae. It has only one species, Lagoecia cuminoides, native to the Mediterranean region and as far east as Iran. Its essential oil contains 72.83–94.76% thymol, quite a bit more than thyme (Thymus vulgaris) itself.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology16
Fruit length4.5 mm
Fruit length max5 mm
Fruit length min4 mm
Fruit width2 mm
Fruit width max2 mm
Fruit width min2 mm
Leaf mass50.53 mg
Leaf size148 mm²
⚠ sources differ — TRY: 148 mm² · LEDA: 1 255 mm² · GIFT: 1 255 mm²
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · LEDA: 0.45 m · TRY: 0.254 m
Plant height generative0.353 m
Plant height max0.8 m
Plant height min0.3 m
Seed length1.65 mm
Seed mass1.75 mg
⚠ sources differ — TRY: 1.75 mg · LEDA: 1.77 mg · GIFT: 33.03 mg
Seed mass max1.83 mg
Seed mass min1.33 mg
Life cycle & reproduction13
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: biennial short_lived_perennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: perennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number3 326
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 200 m
Elevation min1 000 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTLowland
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.02 g/g
Leaf c415 mg/g
Leaf dry-matter content (LDMC)274 mg/g
⚠ sources differ — TRY: 274 mg/g · LEDA: 179 mg/g
Leaf n28.44 mg/g
Leaf p1.85 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.96 mm²/mg
⚠ sources differ — TRY: 17.96 mm²/mg · LEDA: 25.58 mm²/mg · GIFT: 25.58 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Monocarpymonocarp
03Chemical composition6 016 compounds
Compounds documented for Carum carvi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids81
Glycerophospholipids57
Cinnamic acids and derivatives51
Menthane monoterpenoids44
Menthane monoterpenoids $ Monocyclic monoterpenoids43
Documented compounds6 016 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARVONE | 900,000 ppm | DukesPhytochem | |
| CARVACROL | 595,300 ppm | DukesPhytochem | |
| CARBOHYDRATES | 554,000 ppm | DukesPhytochem | |
| LIMONENE | 500,000 ppm | DukesPhytochem | |
| PROTEIN | 400,000 ppm | DukesPhytochem | |
| CUMINALDEHYDE | 370,000 ppm | DukesPhytochem | |
| PETROSELINIC-ACID | 354,000 ppm | DukesPhytochem | |
| OLEIC-ACID | 241,000 ppm | DukesPhytochem |
05DNA & barcoding49 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carum carvi has left across the world's sequence archives.
At a glance
DNA specimens49
Marker genes6
GenBank sequences10
eDNA detections26
Countries9
The DNA barcodea real sequence read deposited for this species
CGTATCGTGTTGCCCCCAACCACTCACTCCTCTGGGAGCTATTCCGGTTTAGGGGCGGAAATTGGCCTCCCGTACCTTGCGGTGCGGATG …
Carum carvi isolate D07 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carum carvi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 863 090 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carum carvi1.86 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records16–222n range20median20mode67records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2045×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Šimková Ľ., 2007: [New records in Carum, Chelidonium, Epilobium, Lathyrus, Linaria, Lychnis, Picris, Primula, Scorzoneroides, Sonchus, Vicia, and Viola], pp. 178, 189, 239, 358, 371, 380, 437, 469, 531, 554, 614, 616, 617, 620. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. I Gard, A. & N. Malheiros-Gard.Agron. Lusit.11(2): 91-140(1949).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3296
CCDB · fl-europaea — Ilakansson, 1953
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1984. Khrom. Chisla Tsvet. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Das, A. B. 1991. Genome analysis and variation of 4C DNA content in the subtribe Carinae. Cytologia 56: 627–632.
CCDB · ipcn-api-dl — Sheidai, M., P. Ahmadian & S. Poorseyedy. 1996. Cytological studies in Iran Zira from three genera: Bunium, Carum and Cuminum. Cytologia 61: 19–25.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Silvestre, S. 1978. Contribucion al estudio cariologicos de la familia Umbelliferae en la peninsula Iberica. 11. Lagascalia 7: 163–172.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Ahmad, I. & A. K. Koul. 1980. In Chromosome number reports LXVIII. Taxon 29: 543.
CCDB · ipcn-api-dl — Javurkova, V. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 400–401.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Das, A. B. & R. Mallick. 1993. Nuclear DNA and chromosome changes within the tribe Amminae. Cytobios 74(298–299): 197–207.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-indian_vol1 — Wanscher, J. H. 1931, 1932 ; Tamam- shjan, S. (Fedorov) ;-Garde, A. & Malheiros-Garde, N. 1949, 1954 ; Hakansson, A. 1953; Tschermak- Woess, E. & Dolezal, R. 1953; Love, A. & Love, D. 1956 b ; Mulligan, G.A, 1959, 1967 ; Bell, C.R. & Constance, L. I960; Kordyum, E.L. 1967 ; Majovsky, J. et a!. 1970 b; Crawford, D. J. & Hartman, R. L. 1972 ; Rostovt- seva, T. S. 1974 ; Javurkova, V. 1979 ; Ahmad, I. & Koul, A.K. 1980 ; Dijks- tra, H. & Speckmann, G. J. 1980.
CCDB · eflora
CCDB · book-fedorov — Wanscher 1931, 1932
CCDB · book-fedorov — TaMaMmJIH 1933
CCDB · book-fedorov — Garde, Malheiros-Garde 1949, 1954
CCDB · book-fedorov — HAkansson 1953
CCDB · book-fedorov — Tschermak-Woess, Dolezal 1953
CCDB · book-fedorov — Love A., LOve D 1956h.
CCDB · book-fedorov — Mulligan 1959
CCDB · book-fedorov — Bell, Constance 1960
CCDB · book-fedorov — Kop):IIOM 19676
CCDB · book-atlas-flowering-plants — Garde & G. 1949
CCDB · Cave1959 — Mulligan 1959
CCDB · CromoCat 2015 — Ahmad, I. & Koul, A. K. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 543.
CCDB · CromoCat 2015 — Belaeva, V. A. & Siplivinsky, V. N. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 857-860.
+5 more references
2n 1611×CCDB · iber-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +4
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · mediterranean
CCDB · ipcn-api-dl — Baltisberger, M. 1991. Cytological investigations of some Greek plants. Fl. Medit. 1: 157–173.
CCDB · ipcn-api-dl — Pimenov, M. G., T. V. Alexeeva & E. V. Kljuykov. 1998. Mediterranean chromosome number reports 8 (905--935). Fl. Medit. 8: 221–245.
CCDB · book-ipcn67-71 — ENGSTRAND, L. 1970. Studies in the Aegean flora XVIII. Notes and chromosome numbers in Aegean Umbelliferae. Bot. Notiser 123: 384-393.
CCDB · book-fedorov — TaMaMmllll 1933
CCDB · book-atlas-flowering-plants — Tamamschjan 1933
CCDB · CromoCat 2015 — Baltisberger, M. (1991a). Cytological investigations of some Greek plants. Fl. Medit. 1: 157-173.
CCDB · CromoCat 2015 — Engstrand, L. (1970). Studies in the Aegean flora XVIII. Notes and chromosome numbers in Aegean Umbelliferae. Bot. Not. 123: 384-393.
CCDB · CromoCat 2015 — Pimenov, M. G. & Shner, J.V. (2008). Reports (1650-1663). In: Kamari, Blanché & Siljak-Yakovlev (eds): Mediterranean chromosome number reports-18 Fl. Medit. 20: 573-582
CCDB · CromoCat 2015 — Pimenov, M.G., T.V. Alexeeva & E.V. Kljuykov. (1998). Mediterranean chromosome number reports-8. Fl. Medit. 8: 221-245.
2n 2211×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1986. Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the south of Siberia. Bot. Žhurn. (Moscow & Leningrad) 71: 116–117.
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · book-ipcn67-71 — GURZENKOV N.N., & P.G. GOROVOY. 1971. Chromosome numbers of Urnbelliferae of the Far East. (in Russian) Bot. Zurn. 56: 1805-1815. HALL, J.B. 1971. Observations on Isoetes in Ghana. Bot. J. Linn soc. 64: 117-139.
CCDB · book-indian_vol1 — Melderis, A. 1930 ; Schulz-Gaebel, H. 1930 ; Delay, C. 1947; Milovidov, P. 1960 ; Cauwet, A.-M. 1968 ; Gurzen- kov, N.N. & Gorovoy, P.G. 1971 ; Sarkar, A.K., Chakraverty, M. et a!. 1977
CCDB · book-fedorov — Melderis 1930
CCDB · book-fedorov — Schulz-Gaebel 1930
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Milovidov 1960
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
CCDB · CromoCat 2015 — Krasnikov, A. A. & Schaulo, D. N. (1986). Chromosome numbers of some representatives of the families Apiaceae and Ranunculaceae from the South of Siberia. Bot. Žurn. 71: 116-117.
n 1013×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +2
CCDB · iber-fl — Contribucin al estudio cariolgico de la familia Umbelliferae en la Pennsula Ibrica. II Silvestre, S.Lagascalia7(2): 163-172(1978).
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Silvestre, S. 1978. Contribucion al estudio cariologicos de la familia Umbelliferae en la peninsula Iberica. 11. Lagascalia 7: 163–172.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · book-ipcn72 — CRAWFORD, D.J., R.L. HARTMAN. 1972. Chromosome numbers and taxonomic notes for Rocky Mountain Umbelliferae. Amer. J. Bot. 59: 386-392.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
CCDB · book-ipcn67-71 — MULLIGAN, G. a. 1967. In IOPB chromosome number reports XIV. Taxon 16: 552-571.
CCDB · CromoCat 2015 — Gardé, A. & Malheiros-Gardé, N. (1949). Contribuiçao para o estudo cariológico da familia Umbelliferae. I. Agron. Lusit. 11(2): 91-140.
CCDB · CromoCat 2015 — Silvestre, S. (1978). Contribución al estudio cariológico de la familia Umbelliferae en la Península Ibérica. II. Lagascalia 7(2): 163-172.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
n 89×CCDB · iber-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +2
CCDB · iber-fl — IOPB. Chromosome data 5 (ed. C.A. Stace). Diosdado, J. C., F. Ojeda & J. Pastor.Int. Organ. Pl. Biosyst. Newslett.20: 6(1993).
CCDB · mediterranean
CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.
CCDB · ipcn-api-dl — Diosdado, J. C., F. Ojeda & J. Pastor. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 6–7.
CCDB · book-ipcn67-71 — CONSTANCE, L . T.-I. CHUANG, & C.R. BELL. 1971. Chromosome numbers in Umbelliferae. IV. Amer. J. Bot. 58: 577-587.
CCDB · CromoCat 2015 — Constance, L., Chuang, T. & Bell, C. R. (1971). Chromosome numbers in Umbelliferae. IV. Amer. J. Bot. 58: 577-587.
CCDB · CromoCat 2015 — Constance, L., Chuang, T. & Bell, C. R. (1976). Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608-625.
CCDB · CromoCat 2015 — Diosdado, J. C., Ojeda, F. & Pastor, J. E. (1993b). IOPB Chromosome Data 5 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 20: 6-7
CCDB · CromoCat 2015 — Pimenov, M. G. & Shner, J.V. (2008). Reports (1650-1663). In: Kamari, Blanché & Siljak-Yakovlev (eds): Mediterranean chromosome number reports-18 Fl. Medit. 20: 573-582
n 114×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · ipcn-api-dl — Sarkar, A. K., M. CHAKRABORTY, N. C. SAHA, S. K. DAS & D. HAZRA. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.
CCDB · CromoCat 2015 — Gardé, A. & Malheiros-Gardé, N. (1949). Contribuiçao para o estudo cariológico da familia Umbelliferae. I. Agron. Lusit. 11(2): 91-140.
CCDB · CromoCat 2015 — Sarkar, A. K., M. Chakraverty, N. C. Saha, S. K. Das & D. Hazra. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVII]. Taxon 26(4): 450.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.960 ↗
07Deep time~22.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin22.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type123 374 records
Wild obs. + sensor112 201
Museum / vouchered9 302
Cultivated / captive525
Other1 346
Origin
Native6
Introduced442
Range
Area of Occupancy AOO209 296 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 23 587≤1 km 15 656≤10 km 45 078>10 km 1 286
85 607 georeferenced · 26 594 without coordinates
Open the mapobservation + sensor112 201
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 737≤1 km 1 822≤10 km 3 076>10 km 216
5 851 georeferenced · 3 451 without coordinates
Open the institutions mapphysical evidence9 302
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy18% within 1 km
≤100 m 2≤1 km 10≤10 km 37>10 km 18
67 georeferenced · 458 without coordinates
Open the mapnot free-living525
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions138 of 255 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 822 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 559 |
| Moscow State Universitylocation not on record | 473 |
| BFLlocation not on record | 465 |
| LDlocation not on record | 289 |
| Salzburg, AT | 283 |
| Olocation not on record | 263 |
| Kuopio, FI | 195 |
| Oulu, FI | 177 |
| Beijing, CN | 163 |
| Trondheim, NO | 144 |
| KMNlocation not on record | 133 |
| Uniwersytet Warszawskilocation not on record | 126 |
| Bergen, NO | 118 |
| Jyväskylä, FI | 111 |
| MeiseBGlocation not on record | 101 |
| Oskarshamn, SE | 97 |
| Québec, CA | 97 |
| TROMlocation not on record | 95 |
| Yangling, CN | 93 |
| Turku, FI | 90 |
| SLU Artdatabankenlocation not on record | 83 |
| Xining, CN | 81 |
| BIO-UNIPIlocation not on record | 77 |
| Madison, US | 69 |
| GMBAlocation not on record | 69 |
| Garðabær, IS | 66 |
| Lausanne, CH | 66 |
| Tartu, EE | 65 |
| Chengdu, CN | 63 |
| Urumqi, CN | 57 |
| BRNUlocation not on record | 53 |
| Nanjing, CN | 52 |
| Philadelphia, US | 50 |
| Adam Mickiewicz University in Poznańlocation not on record | 50 |
| St. Paul, US | 49 |
| Chengdu, CN | 48 |
| TUR-Alocation not on record | 48 |
| Acadia Universitylocation not on record | 47 |
| Saint John, CA | 44 |
| Barcelona, ES | 41 |
| Bern, CH | 40 |
| BDBClocation not on record | 38 |
| Tallinn, EE | 37 |
| Provincia di Livornolocation not on record | 36 |
| Université Lavallocation not on record | 36 |
| Burlington, US | 36 |
| University of New Hampshirelocation not on record | 36 |
| Görlitz, DE | 36 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 35 |
| Bronx, US | 33 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 30 |
| Entomological Society of Latvialocation not on record | 28 |
| Kunming, CN | 28 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 27 |
| Chongqing Museumlocation not on record | 25 |
| Porvoo, FI | 25 |
| Denver, US | 23 |
| New Haven, US | 22 |
| Uppsala, SE | 22 |
| València, ES | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| SXTCMlocation not on record | 21 |
| BClocation not on record | 20 |
| Wlocation not on record | 20 |
| Uniwersytet Śląski w Katowicachlocation not on record | 19 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 19 |
| WNNUlocation not on record | 19 |
| MAlocation not on record | 18 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 18 |
| Montréal, CA | 18 |
| GJOlocation not on record | 18 |
| South Kensington, GB | 18 |
| Zürich, CH | 18 |
| Frankfurt am Main | 17 |
| 17 | |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 17 |
| Ann Arbor, US | 16 |
| Urumqi, CN | 15 |
| Green Bay, US | 15 |
| BSBIlocation not on record | 14 |
| Rovaniemi, FI | 14 |
| ROM007location not on record | 14 |
| Missoula, US | 14 |
| University of Alberta Museumslocation not on record | 13 |
| Zürich, CH | 13 |
| Logan, US | 13 |
| Lanzhou, CN | 12 |
| Guangzhou, CN | 12 |
| Brussel, BE | 12 |
| Bozeman, US | 11 |
| Berlin, DE | 11 |
| Wuzhou, CN | 10 |
| WINlocation not on record | 10 |
| IWEP FEB RASlocation not on record | 10 |
| PRClocation not on record | 10 |
| Dresden, DE | 9 |
| Stockholm, SE | 9 |
| Mlocation not on record | 9 |
| DBF-NHMDlocation not on record | 9 |
| GZUlocation not on record | 9 |
| Nijmegen, NL | 9 |
| WTUlocation not on record | 8 |
| SZUlocation not on record | 8 |
| Glarus, CH | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Bloomington, US | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Toronto, CA | 7 |
| Porrentruy, CH | 7 |
| Frauenfeld, CH | 7 |
| Helsinki, FI | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Shanxi Institute of Biologylocation not on record | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Vancouver, CA | 7 |
| Pocatello, US | 6 |
| Allentown, US | 6 |
| University of Stellenboschlocation not on record | 6 |
| Saint Louis, US | 6 |
| Chicago, US | 6 |
| Jiangxi College of Educationlocation not on record | 6 |
| Philadelphia, US | 6 |
| Davenport, US | 6 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Palacký University in Olomouclocation not on record | 5 |
| Uniwersytet Opolskilocation not on record | 5 |
| Auckland, NZ | 5 |
| Edinburgh, GB | 5 |
| Pullman, US | 5 |
| Forssa, FI | 4 |
| Keene State Universitylocation not on record | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| PrivatHerblocation not on record | 4 |
| Staten Island, US | 4 |
| Tilburg, NL | 4 |
| CJBGlocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Flagstaff, US | 4 |
| Spearfish, US | 4 |
| NMBU:MINAlocation not on record | 4 |
| CZE061location not on record | 4 |
| Karlsruhe, DE | 4 |
| Fulda, DE | 4 |
| University of Lethbridgelocation not on record | 4 |
| Guilin, CN | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| Salamanca, ES | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Dekalb, US | 3 |
| CJBNlocation not on record | 3 |
| nbflocation not on record | 3 |
| University of Wisconsinlocation not on record | 3 |
| Kew, GB | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Taipei, TW | 3 |
| National Museum Waleslocation not on record | 3 |
| Corvallis, US | 3 |
| Sion, CH | 3 |
| BG-NMNHSlocation not on record | 3 |
| Chicago, US | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Shanghai, CN | 3 |
| Hobart, AU | 3 |
| Whitehorse, CA | 3 |
| Winterthur, CH | 3 |
| Seoul, KR | 3 |
| AASlocation not on record | 3 |
| SWE054location not on record | 3 |
| Jurica-Suchy Nature Museumlocation not on record | 3 |
| Bourges, FR | 3 |
| Riverside, US | 3 |
| POL003location not on record | 2 |
| Durham, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| QAUlocation not on record | 2 |
| Bangkok, TH | 2 |
| Kathmandu, NP | 2 |
| Montréal, CA | 2 |
| McWane Science Centerlocation not on record | 2 |
| ROM023location not on record | 2 |
| Paris, FR | 2 |
| Herb. BBGlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Victoria, CA | 2 |
| Columbia, US | 2 |
| Millersville, US | 2 |
| Göteborg, SE | 2 |
| ROM020location not on record | 2 |
| Chadron, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| Xiamen, CN | 2 |
| Granada, ES | 1 |
| Whitewater, US | 1 |
| Honolulu, US | 1 |
| USFS/BHSClocation not on record | 1 |
| College Park, US | 1 |
| Chengdu, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Monastir, TN | 1 |
| San Jose, US | 1 |
| Edmonton, CA | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Kensington, AU | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Macomb, US | 1 |
| Fargo, US | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Guiyang, CN | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Wuhan, CN | 1 |
| Provo, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Guiyang, CN | 1 |
| Cambridge, US | 1 |
| nlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Kingston, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Philadelphia, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Rotorua, NZ | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Sanda, JP | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Pittsburg, US | 1 |
| Mississippi State, US | 1 |
| Christchurch, NZ | 1 |
| Tula State Universitylocation not on record | 1 |
| Wellington, NZ | 1 |
| ESP003location not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Canberra, AU | 1 |
| CASlocation not on record | 1 |
| Podgorica, ME | 1 |
| Ivano-Frankove, UA | 1 |
| HUN003location not on record | 1 |
| AZE014location not on record | 1 |
| Moscow, US | 1 |
| Ypsilanti, US | 1 |
| EL PASO, US | 1 |
| Bend, US | 1 |
| Boise, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
255 institutions · 8 727 of 9 302 vouchered records shown · 551 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Carum carvi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map9 countries0
Grassland hillsidePalearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.9 °C 6.60–24.7
Seasonal swing summer↔winter23.0 °C
Max temp (day)16.4 °C 9.70–30.5
Min temp (night)10.1 °C 0.7–17.3
Precipitation74.6 mm/mo 42.1–117
Air humidity59.9 % 50.3–66.2
Moisture balance-28.2 mm/mo -84.7–43.6
Vapour deficit607 Pa 347–1,638
Wind speed2.90 m/s 1.70–4.70
Cloud cover43.2 % 26.3–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.