Cartrema americana

(L.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Oleaceae/Cartrema

At a glance

Occurrence records1 223

Data sources8

Biological traits13

DNA specimens9

eDNA detections7

Sources8 archives

Databases and archives Cartrema americana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 223 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

عبقة أمريكية هي نوع من النباتات تتبع جنس العبقة من الفصيلة الزيتونية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height14.94 m

Life cycle & reproduction4

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cartrema americana has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN525462.1 ↗276 bpChina

ACGT

TCATTGTCGAAACCTGCAAAACAGACCCGCGAACACGTTATAACTCACAGGGAGGACGGCGCGGGCGCAACCGACCACGTTGTGTCCCGC …

Osmanthus americanus voucher yongfuli 23 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK3★rbcL5★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type1 223 records

Wild obs. + sensor1 050

Museum / vouchered173

Range

Area of Occupancy AOO2 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 646≤1 km 95≤10 km 49>10 km 74

864 georeferenced · 186 without coordinates

Open the mapobservation + sensor1 050

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 20≤1 km 8≤10 km 7

35 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	70
Jackson, US	26
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	24
Valdosta State Universitylocation not on record	23
Guasave, MX	4
Chapel Hill, US	3
Dekalb, US	2
Asheville, US	2
University of South Carolina Salkehatchielocation not on record	2
Riverside, US	1
Columbia, US	1
Claremont, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Kew, GB	1
Tempe, US	1
Saint Louis, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
McWane Science Centerlocation not on record	1
AUAlocation not on record	1
US	1
EL PASO, US	1
Bangkok, TH	1
Centro Interdisciplinario de Investigacion para el Desarrollo Integral Regional Unidad Oaxacalocation not on record	1
University of Stellenboschlocation not on record	1

24 institutions · 171 of 173 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Cartrema americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Humid temperate forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 12.8–15.8

Seasonal swing summer↔winter15.3 °C

Max temp (day)19.6 °C 18.7–20.6

Min temp (night)9.40 °C 8.50–10.4

Precipitation133 mm/mo 90.3–176

Air humidity62.4 % 58.4–66.4

Moisture balance19.1 mm/mo -26.9–65.1

Vapour deficit665 Pa 610–719

Wind speed3.80 m/s 2.10–5.40

Cloud cover33.8 % 31.5–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cartrema americana

At a glance

Sources8 archives

Size & morphology1

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Record type1 223 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 223 records