Cartonema spicatum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Cartonema

At a glance

Occurrence records1 677

Data sources5

Biological traits26

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cartonema spicatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 677 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF1 677 records

DNA & barcodingNCBIsequences

01Narrative

Cartonema spicatum là một loài thực vật có hoa trong họ Commelinaceae. Loài này được R.Br. mô tả khoa học đầu tiên năm 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length200 mm

Leaf width5.5 mm

Plant height0.3 m

Plant height max0.5 m

Plant height min0 m

Seed mass1.4 mg

⚠ sources differ — TRY: 1.4 mg · AusTraits: 1.65 mg

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typeself

Flowering timeyyynnnnnnnnn

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cartonema spicatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLFN870780.1 ↗574 bp

ACGT

ATGTGAAGAAATGATGAAAAGGGCCCAATGTGCCAGAGAATTGGAGTTCCTATCGTAATGCATGACTACTTAACCGGAGGATTCACTGCA …

Cartonema parviflorum plastid partial rbcL gene for RuBisCO, specimen voucher K:Byrnes

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5

plant barcode

08Occurrence & distribution

Record type1 677 records

Wild obs. + sensor1 392

Museum / vouchered262

Cultivated / captive2

Other21

Origin

Native40

Range

Area of Occupancy AOO4 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 721≤1 km 6≤10 km 4>10 km 1

732 georeferenced · 660 without coordinates

Open the mapobservation + sensor1 392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 110≤1 km 16≤10 km 72>10 km 15

213 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence262

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	82
Palmerston, AU	46
Museo Entomologico de Leonlocation not on record	28
Mount Annan, AU	26
Kensington, AU	18
Smithfield, AU	18
Kew, GB	10
Adelaide, AU	7
Canberra, AU	7
Saint Louis, US	4
Honolulu, US	3
BGPAlocation not on record	3
EL PASO, US	2
University of Stellenboschlocation not on record	2
Taipei, TW	1
John T. Waterhouse Herbariumlocation not on record	1
Minia, EG	1
Armidale, AU	1

18 institutions · 260 of 262 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cartonema spicatum

At a glance

Sources5 archives

Size & morphology6

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 677 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 18 geolocated

Cultivated / Captivenot free-living

Record type1 677 records