Carrichtera annua
(L.) DC. · speciesAt a glance
Occurrence records23 421
Data sources10
Biological traits48
DNA specimens7
eDNA detections9
Sources10 archives
Databases and archives Carrichtera annua's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility23 421 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF23 421 records
Environmental DNA2 datasets · 3 countries9 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Carrichtera annua – gatunek roślin z rodziny kapustowatych (Brassicaceae). Jest jedynym przedstawicielem monotypowego w efekcie rodzaju Carrichtera A. P. de Candolle, Mém. Mus. Hist. Nat. 7: 244. 20 Apr 1821. Roślina ta występuje na wyspach Makaronezji, w północnej Afryce, południowej Europie i południowo-zachodniej Azji, jako gatunek zawleczony rośnie także w Australii i Kalifornii, gdzie jest rośliną inwazyjną.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology16
Fruit length6 mm
⚠ sources differ — AusTraits: 6 mm · GIFT: 7 mm
Fruit width3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 4 mm
Leaf length100 mm
Leaf length max60 mm
Leaf length min20 mm
Leaf mass per area27.98 g/m2
Leaf width max30 mm
Leaf width min10 mm
Plant height0.2 m
⚠ sources differ — GIFT: 0.2 m · AusTraits: 0.128 m · TRY: 0.08 m
Plant height max0.4 m
Plant height min0.05 m
Seed length1.25 mm
Seed mass0.854 mg
⚠ sources differ — TRY: 0.854 mg · AusTraits: 0.75 mg · GIFT: 0.894 mg
Seed mass max1.31 mg
Seed mass min0.6 mg
Seed width1.25 mm
Life cycle & reproduction13
Dehiscencedehiscent
Dispersal typewater
Flower colourpurple
Flower length max9 mm
Flower length min7 mm
Flowering endJul
Flowering startFeb
Flowering timennnnnnyyynyn
Life formannual
Life spanannual
Lifespan years2 years
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max800 m
Elevation min10 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: pod
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlinear
Leaf shapelinear
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)13.82 mm²/mg
Other traits1
Plant support typefree-standing
03Chemical composition7 compounds
Compounds documented for Carrichtera annua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Glucosinolates4
Flavonols3
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3-Butenylglucosinolate | present | LOTUS | |
| 4-Pentenylglucosinolate | present | LOTUS | |
| [(2R,3S,4S,5R,6S)-6-[(2R,3R,4S,5S)-2-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-3-yl]oxy-4,5-dihydroxyoxan-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methyl (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate | present | LOTUS | |
| [(2R,3S,4S,5R,6S)-6-[(2R,3S,4S,5S)-2-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-7-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-3-yl]oxy-4,5-dihydroxyoxan-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methyl (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate | present | LOTUS | |
| Gluconapin | present | LOTUS | |
| Quercetin | present | LOTUS | |
| Sinigrin | present | LOTUS |
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carrichtera annua has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes5
GenBank sequences10
eDNA detections9
Countries3
The DNA barcodea real sequence read deposited for this species
TATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACG …
Carrichtera annua voucher EDNA15-0042970 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Carrichtera annua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–322n range16median16mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1648×CCDB · ita-fl · CCDB · iapt · CCDB · iber-fl +9
CCDB · ita-fl — SCRUGLI A., BOCCHIERI E. - 1976. NUmeri cromosomici per la flora italiana:263-269.. Inform. Bot. Ital. , 8(2): 216-223.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Nilsson, O. & P. Lassen.Bot. Not.124: 270-276(1971).
CCDB · iber-fl — Chromosomenzahlen und hinweise auf systematik und verbreitung von Brasicaceae-arten aus Europa, Nordafrika, Asien und Australien. Polatschek, A.Phyton23(1): 127-139(1983).
CCDB · iber-fl — Estudios cariolgicos en crucferas espaolas de los gneros Moricandia DC., Vella L., Carrichtera Adams. y Huerta Porta. Valds Bermejo, E.Anales Inst. Bot. Cavanilles27: 125-133(1970).
CCDB · iber-fl — Chromosome numbers of some flowering plants of Spain and France. Gadella, Th., E. Kliphuis & E. A. Mennega.Acta Bot. Neerl.15(2): 484-489(1966).
CCDB · iber-fl — Estudios citotaxonmicos en crucferas espaolas. Valds Bermejo, E.Las Ciencias34(1): 80-84(1974).
CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Diosdado, J. C., F. Ojeda & J. Pastor. 1993. IOPB chromosome data 5. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 20: 6–7.
CCDB · ipcn-api-dl — Arista, M. & P. L. Ortiz. 1994. Nǔmeros cromosomăticos de plantas occidentales, 681--687. Anales Jard. Bot. Madrid 51(2): 279.
CCDB · ipcn-api-dl — Sharma, A. K. & K. Sikka. 1976. Chromosome studies in Cruciferae. Res. Bull. Univ. Calcutta Cytogenetics Lab. 3: 33–34.
CCDB · ipcn-api-dl — Guittonneau, G. G. 1978. In IOPB chromosome number reports LX. Taxon 27: 223–231.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · book-ipcn66 — Gadella et al. 1966
CCDB · book-ipcn67-71 — VALDES BERMEJO, E. 1970. Estudios cariologicos en cruciferas espanolas de los generos Moricandia DC., Vella L., Carrichtera Adans. y Hutera Porta. --- Anales Inst. Bot. A.J. Cavanilles 27: 125-133.
CCDB · book-ipcn75-78 — Kliphuis & Barkoudah 1977
CCDB · book-ipcn75-78 — Guittonneau 1978
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · eflora
CCDB · brass — Guittonneau
CCDB · brass — Sharma & Sikka
CCDB · brass — Daz Lifante et al.
CCDB · brass — Scrugli & Bocchieri
CCDB · brass — Nilsson & Lassen
CCDB · brass — Arista & Ortiz
CCDB · brass — Sikka & Sharma
CCDB · brass — Manton
CCDB · brass — Gadella et al.
CCDB · brass — Valds-Bermejo
CCDB · brass — Polatschek
CCDB · brass — Luque & Daz Lifante
CCDB · brass — Diosdado et al.
CCDB · brass — Kliphuis & Barkoudah
CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.
CCDB · CromoCat 2015 — Arista, M. & Ortiz, P. L. (1994). Números cromosomáticos de plantas occidentales, 681-687. Anales Jard. Bot. Madrid 51(2): 279.
CCDB · CromoCat 2015 — Diosdado, J. C., Ojeda, F. & Pastor, J. E. (1993b). IOPB Chromosome Data 5 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 20: 6-7
+7 more references
2n 321×CCDB · brass
CCDB · brass — Manton
n 822×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Estudios cariolgicos en crucferas espaolas de los gneros Moricandia DC., Vella L., Carrichtera Adams. y Huerta Porta. Valds Bermejo, E.Anales Inst. Bot. Cavanilles27: 125-133(1970).
CCDB · iber-fl — Estudios cariolgicos sobre la flora espaola. Fernndez Casas, J. & al.Bol. Soc. Brot. ser. 248: 99-105(1974).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 619-630. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 431-437(1990).
CCDB · iber-fl — Estudios citotaxonmicos en crucferas espaolas. Valds Bermejo, E.Las Ciencias34(1): 80-84(1974).
CCDB · ipcn-api-dl — Al-Shehbaz, I. A. & M. M. Al-Omar. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 587–589.
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 619--630. Anales Jard. Bot. Madrid 47: 431–437.
CCDB · ipcn-api-dl — Sharma, A. K. & K. Sikka. 1976. Chromosome studies in Cruciferae. Res. Bull. Univ. Calcutta Cytogenetics Lab. 3: 33–34.
CCDB · book-ipcn67-71 — VALDES BERMEJO, E. 1970. Estudios cariologicos en cruciferas espanolas de los generos Moricandia DC., Vella L., Carrichtera Adans. y Hutera Porta. --- Anales Inst. Bot. A.J. Cavanilles 27: 125-133.
CCDB · brass — Manton
CCDB · brass — Al-Shehbaz & Al-Omar
CCDB · brass — Jaretzky
CCDB · brass — Valds-Bermejo
CCDB · brass — Ruz de Clavijo
CCDB · CromoCat 2015 — Al-Shehbaz, I. A. & Al-Omar, M. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(3): 587-589.
CCDB · CromoCat 2015 — Fernández Casas, J. & Ruíz Rejón, M. (1974a). Estudios cariológicos sobre la flora española. Bol. Soc. Brot. 48: 99-109.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990a). Números cromosomáticos de plantas occidentales, 619-630. Anales Jard. Bot. Madrid 47(2): 431-437.
CCDB · CromoCat 2015 — Valdés Bermejo, E. (1970). Estudios cariológicos en crucíferas españolas de los géneros Moricandia DC., Vella L., Carrichtera Adans. y Hutera Porta. Anales Inst. Bot. Cavanilles 27: 125-133.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.508 ↗
08Occurrence & distribution
Record type23 421 records
Wild obs. + sensor21 961
Museum / vouchered1 439
Cultivated / captive1
Other20
Origin
Native1 476
Introduced17 548
Range
Area of Occupancy AOO34 188 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 6 143≤1 km 10 436≤10 km 3 514>10 km 47
20 140 georeferenced · 1 821 without coordinates
Open the mapobservation + sensor21 961
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 322≤1 km 337≤10 km 351>10 km 59
1 069 georeferenced · 370 without coordinates
Open the institutions mapphysical evidence1 439
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 88 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adelaide, AU | 410 |
| Canberra, AU | 99 |
| MAlocation not on record | 81 |
| València, ES | 76 |
| Kensington, AU | 73 |
| Museo Entomologico de Leonlocation not on record | 43 |
| Mount Annan, AU | 40 |
| College of the Atlantic, Museumlocation not on record | 32 |
| Barcelona, ES | 31 |
| BClocation not on record | 26 |
| Alicante, ES | 23 |
| Zürich, CH | 21 |
| Granada, ES | 20 |
| Palmerston, AU | 20 |
| LDlocation not on record | 19 |
| Wlocation not on record | 16 |
| BDBClocation not on record | 15 |
| Zürich, CH | 14 |
| Brisbane, AU | 14 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 12 |
| Phyletisches Museum Jenalocation not on record | 9 |
| UIBlocation not on record | 9 |
| Armidale, AU | 8 |
| EEZA-CSIClocation not on record | 8 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| Salamanca, ES | 7 |
| Kew, GB | 7 |
| PRClocation not on record | 7 |
| Rishon Le Zion, IL | 7 |
| San Diego, US | 6 |
| Saint Louis, US | 6 |
| Hobart, AU | 6 |
| Entomological Society of Latvialocation not on record | 5 |
| Badajoz, ES | 5 |
| CICYTEXlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Jaén, ES | 5 |
| Claremont, US | 5 |
| Uniwersytet Jagiellońskilocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| BGPAlocation not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Sevilla, ES | 4 |
| Madrid, ES | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Museo Achille Folettolocation not on record | 3 |
| Riverside, US | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Santa Barbara, US | 3 |
| JBSlocation not on record | 3 |
| Auckland, NZ | 2 |
| CJBGlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Pamplona, ES | 2 |
| Vitoria, ES | 2 |
| San Sebastián, ES | 2 |
| EL PASO, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| ESP003location not on record | 2 |
| Paris, FR | 2 |
| Bratislava, SK | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Irvine, US | 1 |
| Santiago de Compostela, ES | 1 |
| JBCLMlocation not on record | 1 |
| Tilburg, NL | 1 |
| Odawara, JP | 1 |
| Davis, US | 1 |
| Frankfurt am Main | 1 |
| Logan, US | 1 |
| BRNUlocation not on record | 1 |
| CASlocation not on record | 1 |
| Corvallis, US | 1 |
| Berlin, DE | 1 |
| GJOlocation not on record | 1 |
| Gijón, ES | 1 |
| Stockholm, SE | 1 |
| Henderson, US | 1 |
| College Park, US | 1 |
| Provo, US | 1 |
| Wuzhou, CN | 1 |
| BSBIlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| South Kensington, GB | 1 |
| Phoenix, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Mexico City, MX | 1 |
| Australian Museum, Sydneylocation not on record | 1 |
88 institutions · 1 295 of 1 439 vouchered records shown · 144 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Carrichtera annua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys2
Countries3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map3 countries0
Edge of coastal sage scrub. Adolphia califor…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 12.5–13.8
Seasonal swing summer↔winter16.9 °C
Max temp (day)18.8 °C 16.9–18.8
Min temp (night)8.00 °C 7.50–9.00
Precipitation54.0 mm/mo 41.3–54.0
Air humidity53.3 % 53.3–59.9
Moisture balance-63.7 mm/mo -63.7–-37.3
Vapour deficit732 Pa 583–732
Wind speed3.80 m/s 2.70–3.80
Cloud cover31.9 % 27.4–33.7
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.