Carphephorus odoratissimus

(J.F.Gmel.) H.J.-C.Hebert · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Carphephorus

At a glance

Occurrence records268

Data sources11

Biological traits7

DNA specimens0

eDNA detections12

Sources11 archives

Databases and archives Carphephorus odoratissimus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility268 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionDukesPhytochem · NPASS28 compounds

Occurrence & distributionGBIF268 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Carphephorus odoratissimus (syn. Trilisa odoratissima), common name vanillaleaf, is a species of North American plants in the family Asteraceae. This species is native to the southeastern United States, including the states of Georgia, North Carolina, South Carolina, Alabama, Mississippi, Louisiana, and Florida.Biota of North America Program 2014 county distribution mapHenry J.-C. Hebert. 1968. Generic considerations concerning Carphephorus and Trilisa (Compositae). Rhodora 70:474-485 Carphephorus odoratissimus is a herbaceous perennial up to 180 cm (6 feet) in height, and is largely glabrous. It produces a flat-topped inflorescence with many small purplish flower heads containing disc florets but no ray florets.Flora of North America, Vanillaleaf, Carphephorus odoratissimus (J.F. Gmel.) H.J.-C. Hebert Varieties Carphephorus odoratissimus var. odoratissimus - Georgia, North Carolina, South Carolina, Alabama, Mississippi, Louisiana, and Florida Carphephorus odoratissimus var. subtropicanus Wunderlin & B.F.Hansen - Central and South Florida

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition28 compounds

Compounds documented for Carphephorus odoratissimus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile4 classes

Gallotannins10

Ursane and Taraxastane triterpenoids1

Flavonols1

Glutinane triterpenoids1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
CIS-O-HYDROXYCINNAMIC-ACID	30,000 ppm	DukesPhytochem
COUMARIN	16,000 ppm	DukesPhytochem
TRANS-O-HYDROXYCINNAMIC-ACID	12,500 ppm	DukesPhytochem

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carphephorus odoratissimus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ416342.1 ↗649 bp

ACGT

TCGAACCCTGGATGGCAAAACAACCCGTGAACGTGTATCAACAAGATGGCTCGGCGGGTGTCGATGCTCTTTTTGTATCGAAACCTGGCC …

Trilisa odoratissima voucher Delaney 4022, TENN internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carphephorus odoratissimus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — GAISER, L.O. 1954. Studies in the Kuhniinae (Eupatorieae) II. J. Arnold Arb. 35: 87-133.

CCDB · book-fedorov — Jones S. B. 1966

n 101×CCDB · book-ipcn66

CCDB · book-ipcn66 — S. B. Jones 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type268 records

Museum / vouchered268

Range

Area of Occupancy AOO820 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 7≤1 km 13≤10 km 28>10 km 45

93 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence268

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	38
Jena Microbial Resource Collectionlocation not on record	37
Miami, US	34
Bangkok, TH	22
Bronx, US	14
University of Stellenboschlocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
Mississippi State, US	11
US	10
University of Southern Mississippilocation not on record	9
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	6
Tuscaloosa, US	6
Chongqing Museumlocation not on record	6
GAlocation not on record	6
Tall Timbers Research Stationlocation not on record	5
Bloomington, US	5
Chapel Hill, US	4
Wuzhou, CN	4
Saint Louis, US	4
EL PASO, US	3
AUAlocation not on record	3
Little Rock, US	2
Williamsburg, US	2
Clemson, US	2
Tempe, US	2
Columbia, US	1
Dover, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
College Park, US	1
San Angelo, US	1
Knoxville, US	1
Dekalb, US	1

32 institutions · 268 of 268 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Carphephorus odoratissimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)