Carmichaelia exsul

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Carmichaelia

At a glance

Occurrence records172

Data sources6

Biological traits29

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Carmichaelia exsul's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF172 records

DNA & barcodingNCBIsequences

01Narrative

Carmichaelia exsul is a flowering plant in the legume family. It is the only species of the genus Carmichaelia found in Australia. The specific epithet means an exile, with reference to it being the only species in its genus native outside New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length11 mm

Leaf length13.5 mm

Leaf length max20 mm

Leaf length min7 mm

Leaf width9.5 mm

Leaf width max15 mm

Leaf width min4 mm

Plant height2 m

Plant height max3.5 m

Plant height min1 m

Seed length3 mm

Seed mass15.67 mg

Life cycle & reproduction6

Dehiscencedehiscent

Flowering endJan

Flowering startNov

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesscompound

Leaf shapeoblong obovate

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carmichaelia exsul has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF113850.1 ↗643 bp

ACGT

TCATTGTCGTTGCCTCACATGCAGACCAACTCGTGAATCTGTTTGAATACATAGGGATGGGTCGTGGTGTTTGGCAGCACGACCTCCCTT …

Carmichaelia exsul internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type172 records

Wild obs. + sensor107

Museum / vouchered64

Cultivated / captive1

Origin

Native12

Introduced3

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 107

107 georeferenced

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 9≤1 km 1≤10 km 20>10 km 2

32 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence64

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	15
Christchurch, NZ	15
Museo Entomologico de Leonlocation not on record	8
Brisbane, AU	6
Canberra, AU	5
Auckland, NZ	4
Wellington, NZ	2
Kew, GB	2
Hobart, AU	2
Rotorua, NZ	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Tampa, US	1

12 institutions · 63 of 64 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)