Carlowrightia torreyana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Carlowrightia

At a glance

Occurrence records273

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Carlowrightia torreyana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF273 records

DNA & barcodingNCBIsequences

01Narrative

Carlowrightia torreyana là một loài thực vật có hoa trong họ Ô rô. Loài này được Wassh. mô tả khoa học đầu tiên năm 1965.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carlowrightia torreyana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEU087439.1 ↗453 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCGAGGCAGACCCGCGAACGCGTCCTCCAACGTCGGCGACGCGGCTCC …

Carlowrightia torreyana internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type273 records

Wild obs. + sensor200

Museum / vouchered73

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 127≤1 km 8≤10 km 3>10 km 34

172 georeferenced · 28 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 18≤1 km 8≤10 km 6>10 km 4

36 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	21
Ann Arbor, US	11
Bronx, US	6
Fort Worth, US	6
Mexico City, MX	4
ASUlocation not on record	4
Uppsala, SE	3
La Paz, MX	2
Mexico City, MX	2
Austin, US	2
Bloomington, US	2
Durango, US	2
Saint Louis, US	2
EL PASO, US	1
Riverside, US	1
Pomona Collegelocation not on record	1
Denver, US	1
University of Stellenboschlocation not on record	1
BAYLUlocation not on record	1

19 institutions · 73 of 73 vouchered records shown