Carlina salicifolia

(L.fil.) Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Carlina

At a glance

Occurrence records1 870

Data sources10

Biological traits20

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Carlina salicifolia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 870 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources20 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF1 870 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

upright Carlina salicifolia is a species of thistle found in Macaronesia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology7

Leaf length max170 mm

Leaf length min70 mm

Leaf width max30 mm

Leaf width min10 mm

Plant height0.85 m

Plant height max2 m

Plant height min0.8 m

Life cycle & reproduction8

Deciduousnessevergreen

Flower colouryellow

Flower width max30 mm

Flower width min20 mm

Flowering endAug

Flowering startApr

Life spanperennial

Lifespan years6 years

Habitat & environment5

Elevation max1 600 m

Elevation min200 m

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb/non-woody

Leaf formelliptic

Woodinessnon-woody

03Chemical composition8 compounds

Compounds documented for Carlina salicifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Cadinane sesquiterpenoids4

Fatty aldehydes $ Unsaturated fatty acids2

Unsaturated fatty acids2

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(5R,8R)-3-hydroxy-5-methyl-8-propan-2-yl-5,6,7,8-tetrahydronaphthalene-2-carbaldehyde	present	NPASS
2-Naphthaldehyde, 3-hydroxy-8-isopropyl-5-methyl-	present	NPASS
3-Hydroxy-7-methoxy-5-methyl-8-propan-2-ylnaphthalene-2-carbaldehyde	present	NPASS
7-Hydroxycadalene	present	NPASS
[(2E,8E,10E)-trideca-2,8,10,12-tetraen-4,6-diynyl] acetate	present	LOTUS
Trideca-2,10,12-trien-4,6,8-triynal	present	LOTUS
Trideca-2,8,10,12-tetraen-4,6-diynyl acetate	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carlina salicifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN783770.1 ↗683 bpSpain

ACGT

GTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAAC …

Carlina salicifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Carlina salicifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Meusel, H. & A. Kästner. 1990. Lebensgeschichte der Gold- und Silberdisteln[.] Monographie der Mediterran--Mitteleuropäischen Compositen-Gattung Carlina Band I[.] Merkmalsspektren und Lebensräume der Gattung. Oesterr. Akad. Wiss., Math.-Naturwiss. Kl., Denkschr. 127: 1–294.

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 870 records

Wild obs. + sensor1 809

Museum / vouchered61

Range

Area of Occupancy AOO2 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 753≤1 km 257≤10 km 355>10 km 47

1 412 georeferenced · 397 without coordinates

Open the mapobservation + sensor1 809

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 9≤10 km 2

17 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	9
Wlocation not on record	8
MAlocation not on record	5
BClocation not on record	4
Moscow State Universitylocation not on record	3
Entomological Society of Latvialocation not on record	3
Uppsala, SE	2
Barcelona, ES	2
Saint Louis, US	2
College of the Atlantic, Museumlocation not on record	2
Madrid, ES	1
Görlitz, DE	1
Olocation not on record	1
John May Museum of Natural Historylocation not on record	1
Alicante, ES	1
Berlin, DE	1
Salamanca, ES	1
València, ES	1
BRNUlocation not on record	1
Museo Achille Folettolocation not on record	1
San Sebastián, ES	1
Granada, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Vitoria, ES	1
Kew, GB	1
STUlocation not on record	1

26 institutions · 56 of 61 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carlina salicifolia

At a glance

Sources10 archives

Size & morphology7

Life cycle & reproduction8

Habitat & environment5

Compound class profile3 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 870 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 26 geolocated

Record type1 870 records