Carlina racemosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Carlina

At a glance

Occurrence records1 729

Data sources11

Biological traits10

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Carlina racemosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 729 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF1 729 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Carlina racemosa é uma espécie de planta com flor pertencente à família Asteraceae. A autoridade científica da espécie é L., tendo sido publicada em Species Plantarum 2: 829. 1753. Os seus nomes comuns são cardo-asnil ou carlina.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology2

Plant height0.134 m

Seed mass0.795 mg

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment3

Aquaticterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)314 mg/g

Specific leaf area (SLA)14.51 mm²/mg

03Chemical composition15 compounds

Compounds documented for Carlina racemosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Oleanane triterpenoids11

Fatty aldehydes $ Unsaturated fatty acids2

Unsaturated fatty acids2

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,12aS,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-9-oxo-2,3,4a,5,6,7,8,10,12,12a,14,14a-dodecahydro-1H-picen-3-yl]oxy]-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9R,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9S,10S,12aS,14aR,14bR)-9,10-dihydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9S,10S,12aS,14aR,14bR)-9,10-dihydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9S,10S,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-10-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9S,10S,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-10-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid	present	NPASS
(2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,9S,10S,12aS,14aR,14bR)-9-hydroxy-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-10-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxy-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid	present	NPASS
[(2E,8E,10E)-trideca-2,8,10,12-tetraen-4,6-diynyl] acetate	present	LOTUS
Soyasapogenol B 3-O-beta-glucuronide	present	NPASS
Soyasapogenol B-1	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carlina racemosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ138016.1 ↗301 bpPortugal · 2019

ACGT

GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCC …

Carlina racemosa voucher PLT.0355 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★trnL-F★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carlina racemosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 206×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 110-115. Devesa, J. A.Lagascalia9(1): 126-128(1979).

CCDB · fl-europaea — Fernandes & Queiros

CCDB · ipcn-api-dl — Meusel, H. & A. Kästner. 1990. Lebensgeschichte der Gold- und Silberdisteln[.] Monographie der Mediterran--Mitteleuropäischen Compositen-Gattung Carlina Band I[.] Merkmalsspektren und Lebensräume der Gattung. Oesterr. Akad. Wiss., Math.-Naturwiss. Kl., Denkschr. 127: 1–294.

CCDB · ipcn-api-dl — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. 1994. Notas cariolo|3gicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97–101.

CCDB · ipcn-api-dl — Devesa, J. A. 1979. In Numeros cromosomicos para la flora Espanola. 84-120. Lagascalia 9: 115–130.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 729 records

Wild obs. + sensor1 500

Museum / vouchered211

Other18

Origin

Native57

Range

Area of Occupancy AOO4 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 318≤1 km 133≤10 km 372>10 km 27

850 georeferenced · 650 without coordinates

Open the mapobservation + sensor1 500

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 4≤1 km 71≤10 km 26>10 km 1

102 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ISAlocation not on record	33
College of the Atlantic, Museumlocation not on record	21
BClocation not on record	17
CICYTEXlocation not on record	17
Badajoz, ES	17
Córdoba, ES	16
Salamanca, ES	13
MAlocation not on record	13
Jaén, ES	11
Madrid, ES	10
Wlocation not on record	6
Barcelona, ES	4
València, ES	3
LDlocation not on record	3
Kew, GB	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Museo Achille Folettolocation not on record	2
BIO-UNIPIlocation not on record	2
South Kensington, GB	2
Alicante, ES	2
Vitoria, ES	1
Paris, FR	1
Entomological Society of Latvialocation not on record	1
San Sebastián, ES	1
Research Center in Biodiversity and Genetic Resourceslocation not on record	1
Coimbra, PT	1
Sevilla, ES	1
Granada, ES	1
EEZA-CSIClocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Rishon Le Zion, IL	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
CIBIOlocation not on record	1
STUlocation not on record	1

34 institutions · 210 of 211 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Carlina racemosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–20.2

Seasonal swing summer↔winter16.9 °C

Max temp (day)25.9 °C

Min temp (night)13.5 °C

Precipitation31.8 mm/mo

Air humidity52.8 %

Moisture balance-133 mm/mo

Vapour deficit1,120 Pa

Wind speed2.70 m/s

Cloud cover35.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carlina racemosa

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction2

Diet & foraging1

Habitat & environment3

Physiology & chemistry2

Compound class profile3 classes

Documented compounds15 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 729 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 729 records