Carlina corymbosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Carlina

At a glance

Occurrence records10 067

Data sources12

Biological traits19

DNA specimens2

eDNA detections1

Sources12 archives

Databases and archives Carlina corymbosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 067 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF10 067 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

La Carline en corymbe est une espèce de plante appartenant au genre Carlina et à la famille des Astéracées. Elle pousse essentiellement sur le pourtour méditerranéen, sur des terrains ensoleillés, sablonneux ou rocailleux.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology5

Leaf size746 mm²

Plant height0.306 m

Seed mass1.36 mg

Seed mass max2.43 mg

Seed mass min0.29 mg

Life cycle & reproduction2

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio18.63 g/g

Leaf c423 mg/g

Leaf dry-matter content (LDMC)163 mg/g

Leaf n22.69 mg/g

Leaf p1.46 mg/g

Specific leaf area (SLA)11.73 mm²/mg

03Chemical composition9 compounds

Compounds documented for Carlina corymbosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones5

Pyrrolizidine alkaloids2

Unsaturated fatty acids2

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-8-[(2R,3S,4R,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-8-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-6-[(2R,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one	present	LOTUS
5-Octadecenoic acid	present	LOTUS
5Z-Octadecenoic acid	present	LOTUS
Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside	present	LOTUS
Lucenin-2	present	LOTUS
Orientin	present	LOTUS
Senecionine	present	NPASS
Seneciphylline	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carlina corymbosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU571460.1 ↗344 bp

ACGT

TTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCAAAGCAGAACGACCCGCGAA …

Carlina corymbosa voucher HAL098709 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carlina corymbosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records18–202n range20median20mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · fl-europaea — Arata, 1944

CCDB · ipcn-api-dl — Kuzmanov, B. & S. Georgieva. 1983. In: IOPB chromosome number reports LXXXI. Taxon 32: 665.

CCDB · ipcn-api-dl — Parra, R., B. Valdés, I. Fernández, F. A. Holguín, L. M. Rubio & O. Ruiz. 1999. Números cromosómicos de plantas de Marruecos, III. Lagascalia 21(1): 149–154.

CCDB · book-fedorov — Arata 1944

CCDB · book-atlas-flowering-plants — Medit.

CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1983). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXXI]. Taxon 32(4): 665.

CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1991). Kariologicno izsledvane na balgarski Sloznocvetni. IV. Tribus Carduae Cass. Fitologija 39: 3-22.

CCDB · CromoCat 2015 — Parra, R., B. Valdés, I. Fernández, F.A. Holguín , L.M. Rubio & O. Ruiz (1999a). Números cromosomáticos de plantas de Marruecos, III. Lagascalia 21(1): 149-153.

2n 187×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +2

CCDB · ita-fl — BARTOLO G., BRULLO S., GRILLO M., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:382-397.. Inform. Bot. Ital. , 10(1): 64-80.

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · fl-europaea — Fernandes & Queiros,

CCDB · ipcn-api-dl — Meusel, H. & A. Kästner. 1990. Lebensgeschichte der Gold- und Silberdisteln[.] Monographie der Mediterran--Mitteleuropäischen Compositen-Gattung Carlina Band I[.] Merkmalsspektren und Lebensräume der Gattung. Oesterr. Akad. Wiss., Math.-Naturwiss. Kl., Denkschr. 127: 1–294.

CCDB · CromoCat 2015 — Meusel, H. & A. Kästner. (1990). Lebensgeschichte der Gold- und Silberdisteln[.] Monographie der Mediterran--Mitteleuropäischen Compositen-Gattung Carlina Band I[.] Merkmalsspektren und Lebensräume der Gattung. Oesterreichische Akademie der Wissenschaften

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.

CCDB · CromoCat 2015 — Bartolo, G., S. Brullo, M. Grillo, P. Pavone & A. Zizza. (1978b). Numeri cromosomatici per la Flora Italiana: 382-397. Inf. Bot. Ital. 10: 64-80.

n 01×CCDB · CromoCat 2015

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 067 records

Wild obs. + sensor8 987

Museum / vouchered698

Cultivated / captive1

Other381

Origin

Introduced62

Range

Area of Occupancy AOO18 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 3 885≤1 km 708≤10 km 2 249>10 km 30

6 872 georeferenced · 2 115 without coordinates

Open the mapobservation + sensor8 987

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 11≤1 km 62≤10 km 41>10 km 1

115 georeferenced · 583 without coordinates

Open the institutions mapphysical evidence698

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	336
Berlin, DE	73
CICYTEXlocation not on record	28
Vitoria, ES	27
BDBClocation not on record	26
BClocation not on record	25
Barcelona, ES	24
Institut und Museum fuer Geologie und Palaeontologielocation not on record	21
LDlocation not on record	19
Wlocation not on record	15
San Sebastián, ES	13
Universidad del Pais Vasco (UPV/EHU)location not on record	9
Paris, FR	6
MAlocation not on record	6
Salamanca, ES	5
Görlitz, DE	4
Pamplona, ES	4
Badajoz, ES	3
UIBlocation not on record	3
Madrid, ES	3
Moscow State Universitylocation not on record	3
JBSlocation not on record	3
València, ES	3
Granada, ES	3
Jaén, ES	3
Adam Mickiewicz University in Poznańlocation not on record	2
Bratislava, SK	2
BRNUlocation not on record	2
Coimbra, PT	2
GZUlocation not on record	2
Córdoba, ES	1
Sevilla, ES	1
College of the Atlantic, Museumlocation not on record	1
Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze \| Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record	1
Frankfurt am Main	1
Canadian Department of Agriculturelocation not on record	1
Entomological Society of Latvialocation not on record	1
Oskarshamn, SE	1
SLU Artdatabankenlocation not on record	1
Museo Achille Folettolocation not on record	1
Göteborg, SE	1
Provincia di Livornolocation not on record	1
Oswego, US	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
University of Stellenboschlocation not on record	1

45 institutions · 690 of 698 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Carlina corymbosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carlina corymbosa

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Physiology & chemistry6

Compound class profile3 classes

Documented compounds9 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type10 067 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type10 067 records