Carlina biebersteinii

Bernh. ex Hornem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Carlina

At a glance

Occurrence records7 507

Data sources9

Biological traits31

DNA specimens1

eDNA detections31

Sources9 archives

Databases and archives Carlina biebersteinii's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 507 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF7 507 records

Environmental DNA2 datasets · 1 countries31 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Carlina biebersteinii is a purple-flowered herb in the tribe Cardueae of the family Asteraceae. It is found in Europe, Russia, Kazakhstan and in the Xinjiang region of China.Flora of China vol 20-21 p 39 Carlina biebersteinii Bernh. ex Hornem., Suppl. Hort. Bot. Hafn. 94. 1819.J.W. Hornemann, Supplementum Horti botanici hafniensis 94. 1819. Subspecies: Carlina biebersteinii var. fennica Meusel & Kästner (synonym: Carlina fennica (Meusel & Kästner) Tzvelev)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length3 mm

Fruit length max4 mm

Fruit length min2 mm

Leaf length95 mm

Leaf length max150 mm

Leaf length min40 mm

Leaf size108 mm²

Leaf width12.5 mm

Leaf width max20 mm

Leaf width min5 mm

Plant height0.7 m

⚠ sources differ — GIFT: 0.7 m · TRY: 0.35 m

Plant height max1.2 m

Plant height min0.2 m

Seed mass0.687 mg

⚠ sources differ — TRY: 0.687 mg · GIFT: 1.23 mg

Seed mass max1.23 mg

Seed mass min1.23 mg

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endSep

Flowering startJul

Life formbiennial

Life spanbiennial/perennial

⚠ sources differ — TRY: biennial/perennial · GIFT: biennial

Raunkiær life formhemicryptophyte

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTcut-overforest,dump,forest,forestedges,meadows:dry,mountains,parks

Mycorrhiza type0.00000000405

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carlina biebersteinii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections31

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK238394.1 ↗647 bp

ACGT

CCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCAAAGCAGAACGACCCGCGAACGTGTAAAACACAACCGGCGGCGTGCGCTT …

Carlina biebersteinii isolate BY16891 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carlina biebersteinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 209×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · eflora +1

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · ipcn-api-dl — Meusel, H. & A. Kästner. 1990. Lebensgeschichte der Gold- und Silberdisteln[.] Monographie der Mediterran--Mitteleuropäischen Compositen-Gattung Carlina Band I[.] Merkmalsspektren und Lebensräume der Gattung. Oesterr. Akad. Wiss., Math.-Naturwiss. Kl., Denkschr. 127: 1–294.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.

CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · eflora

CCDB · book-fedorov — MyKcauona ueony6JJ.

CCDB · book-fedorov — QyKcauona ueorry6n.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 507 records

Wild obs. + sensor7 045

Museum / vouchered407

Other55

Origin

Native1

Introduced3

Range

Area of Occupancy AOO17 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 3 158≤1 km 649≤10 km 929>10 km 384

5 120 georeferenced · 1 925 without coordinates

Open the mapobservation + sensor7 045

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 34≤1 km 60≤10 km 68>10 km 24

186 georeferenced · 221 without coordinates

Open the institutions mapphysical evidence407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	88
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	53
BFLlocation not on record	51
Uniwersytet Wrocławskilocation not on record	25
BRNUlocation not on record	21
Kuopio, FI	16
Adam Mickiewicz University in Poznańlocation not on record	13
Frauenfeld, CH	8
Turku, FI	8
The State Museum-Preserve "The Kulikovo pole"location not on record	8
Helsinki, FI	8
Bern, CH	7
TUR-Alocation not on record	6
Zürich, CH	6
Oulu, FI	6
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	5
Görlitz, DE	4
Tula State Universitylocation not on record	4
South Kensington, GB	4
Wlocation not on record	4
Salzburg, AT	2
GJOlocation not on record	2
Porvoo, FI	2
BClocation not on record	2
Tampere, FI	2
Kew, GB	1
Beijing, CN	1
Urumqi, CN	1
Provincia di Livornolocation not on record	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Bloomington, US	1
SZUlocation not on record	1
Jyväskylä, FI	1
Palacký University in Olomouclocation not on record	1

34 institutions · 364 of 407 vouchered records shown · 42 without an institution code

09Environmental DNA31 detections

Where the DNA of Carlina biebersteinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 7.60–7.60

Seasonal swing summer↔winter21.4 °C

Max temp (day)10.6 °C

Min temp (night)5.20 °C

Precipitation56.6 mm/mo

Air humidity64.8 %

Moisture balance5.20 mm/mo

Vapour deficit367 Pa

Wind speed5.70 m/s

Cloud cover55.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carlina biebersteinii

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction6

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 507 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 507 records