Carissa ovata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Carissa

At a glance

Occurrence records2 769

Data sources8

Biological traits23

DNA specimens8

eDNA detections5

Sources8 archives

Databases and archives Carissa ovata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 769 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources23 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF2 769 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Carissa ovata, aussi appelé carissa éperon, est une espèce de plantes à fleurs de la famille des Apocynaceae. C'est un arbuste qui pousse notamment en Australie et en Nouvelle-Calédonie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraits

Size & morphology10

Fruit length16 mm

Fruit width10.5 mm

Leaf length18 mm

Leaf mass per area137 g/m2

Leaf size170 mm²

Leaf width13 mm

Petiole length0.2 cm

Plant height4 m

Seed length6.5 mm

Seed width3.5 mm

Life cycle & reproduction5

Dispersal typeanimal

Flowering timeyyyyyynnnnnn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Habitat & environment6

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapeorbicular ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition9 compounds

Compounds documented for Carissa ovata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids4

Cinnamic acids and derivatives2

Ursane and Taraxastane triterpenoids1

Eudesmane sesquiterpenoids1

Disaccharides1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,4aR,8R,8aR)-8-[(E)-5-hydroxy-3-methylpent-3-enyl]-4,4,7,8a-tetramethyl-1,2,3,4a,5,8-hexahydronaphthalen-2-ol	present	NPASS
(E)-3-[3-[(2E)-3,7-dimethylocta-2,6-dienyl]-4-hydroxyphenyl]prop-2-enoic acid	present	NPASS
[(E)-5-[(1R,4aR,7S,8aR)-7-acetyloxy-2,5,5,8a-tetramethyl-1,4,4a,6,7,8-hexahydronaphthalen-1-yl]-3-methylpent-2-enyl] acetate	present	NPASS
[(E)-5-[(1R,4aR,7S,8aR)-7-hydroxy-2,5,5,8a-tetramethyl-1,4,4a,6,7,8-hexahydronaphthalen-1-yl]-3-methylpent-2-enyl] acetate	present	NPASS
[(E)-5-[(1R,4aR,8aR)-2,5,5,8a-tetramethyl-7-oxo-4,4a,6,8-tetrahydro-1H-naphthalen-1-yl]-3-methylpent-2-enyl] acetate	present	NPASS
benzoyl (1S,2S,4R,4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-benzoyloxy-1,2,6a,6b,9,9,12a-heptamethyl-1,2,3,4,4a,5,6,6a,7,8,8a,10,11,12,13,14b-hexadecahydropicene-4-carboxylate	present	LOTUS
beta-D-Fructofuranosyl beta-D-glucopyranoside	present	LOTUS
Carissone	present	LOTUS
Drupanin	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carissa ovata has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496589.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCA …

Carissa ovata isolate BATT849-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 769 records

Wild obs. + sensor919

Museum / vouchered455

Cultivated / captive1

Other1 394

Origin

Native12

Range

Area of Occupancy AOO7 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 407≤1 km 79≤10 km 18>10 km 74

578 georeferenced · 341 without coordinates

Open the mapobservation + sensor919

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 100≤1 km 50≤10 km 168>10 km 79

397 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence455

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	207
Museo Entomologico de Leonlocation not on record	61
Canberra, AU	59
Smithfield, AU	58
Palmerston, AU	21
Kensington, AU	13
Adelaide, AU	6
James Cook Townsvillelocation not on record	4
Saint Louis, US	4
Hobart, AU	3
Kew, GB	2
Auckland, NZ	2
St. Paul, US	2
Beijing, CN	1
Bronx, US	1
Zürich, CH	1
Wollongong, AU	1
Mount Annan, AU	1
Australian Tropical Herbariumlocation not on record	1
Miami, US	1
LDlocation not on record	1

21 institutions · 450 of 455 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Carissa ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 19.7–22.4

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 25.8–28.5

Min temp (night)15.0 °C 13.2–16.9

Precipitation15.6 mm/mo 15.6–76.4

Air humidity43.4 % 43.4–57.9

Moisture balance-143 mm/mo -143–-57.9

Vapour deficit1,624 Pa 1,039–1,624

Wind speed4.00 m/s 3.00–4.00

Cloud cover18.1 % 18.1–28.0

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carissa ovata

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction5

Habitat & environment6

Physiology & chemistry2

Compound class profile5 classes

Documented compounds9 total

At a glance

Record type2 769 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 769 records