Carissa haematocarpa

(Eckl.) A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Carissa

At a glance

Occurrence records1 346

Data sources5

Biological traits15

DNA specimens3

eDNA detections2

Sources5 archives

Databases and archives Carissa haematocarpa's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF1 346 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub, treee (ST)

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio26.46 g/g

Leaf c389 mg/g

Leaf dry-matter content (LDMC)486 mg/g

Leaf n14.7 mg/g

Leaf p0.8 mg/g

Specific leaf area (SLA)3.86 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carissa haematocarpa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF147457.1 ↗552 bpSouth Africa · 2010

ACGT

AGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACTAAAGATACTGATATCTTGGCAGCA …

Carissa haematocarpa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type1 346 records

Wild obs. + sensor1 280

Museum / vouchered65

Cultivated / captive1

Range

Area of Occupancy AOO3 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 017≤1 km 44≤10 km 20>10 km 19

1 100 georeferenced · 180 without coordinates

Open the mapobservation + sensor1 280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	53
Saint Louis, US	2
University of Johannesburglocation not on record	1
Cape Town, ZA	1
University of Stellenboschlocation not on record	1
PRClocation not on record	1

6 institutions · 59 of 65 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Carissa haematocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter10.6 °C

Max temp (day)17.8 °C

Min temp (night)7.10 °C

Precipitation37.2 mm/mo

Air humidity59.5 %

Moisture balance-61.5 mm/mo

Vapour deficit585 Pa

Wind speed3.90 m/s

Cloud cover12.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carissa haematocarpa

At a glance

Sources5 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

Physiology & chemistry6

At a glance

Record type1 346 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 346 records